ID: 1022499979

View in Genome Browser
Species Human (GRCh38)
Location 7:30876731-30876753
Sequence AAGCACTCCTGCTGCCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022499979_1022499990 25 Left 1022499979 7:30876731-30876753 CCTGAGGGGCAGCAGGAGTGCTT No data
Right 1022499990 7:30876779-30876801 ATTCTTGGAGGGTCCGGATGAGG No data
1022499979_1022499986 14 Left 1022499979 7:30876731-30876753 CCTGAGGGGCAGCAGGAGTGCTT No data
Right 1022499986 7:30876768-30876790 CCCCTGCAAAGATTCTTGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 138
1022499979_1022499989 19 Left 1022499979 7:30876731-30876753 CCTGAGGGGCAGCAGGAGTGCTT No data
Right 1022499989 7:30876773-30876795 GCAAAGATTCTTGGAGGGTCCGG No data
1022499979_1022499982 10 Left 1022499979 7:30876731-30876753 CCTGAGGGGCAGCAGGAGTGCTT No data
Right 1022499982 7:30876764-30876786 CCACCCCCTGCAAAGATTCTTGG No data
1022499979_1022499984 13 Left 1022499979 7:30876731-30876753 CCTGAGGGGCAGCAGGAGTGCTT No data
Right 1022499984 7:30876767-30876789 CCCCCTGCAAAGATTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022499979 Original CRISPR AAGCACTCCTGCTGCCCCTC AGG (reversed) Intronic