ID: 1022499981

View in Genome Browser
Species Human (GRCh38)
Location 7:30876764-30876786
Sequence CCAAGAATCTTTGCAGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022499981_1022499990 -8 Left 1022499981 7:30876764-30876786 CCACCCCCTGCAAAGATTCTTGG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1022499990 7:30876779-30876801 ATTCTTGGAGGGTCCGGATGAGG No data
1022499981_1022499993 22 Left 1022499981 7:30876764-30876786 CCACCCCCTGCAAAGATTCTTGG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1022499993 7:30876809-30876831 CACCACCTATCCTCAGAACCAGG 0: 1
1: 0
2: 1
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022499981 Original CRISPR CCAAGAATCTTTGCAGGGGG TGG (reversed) Intronic