ID: 1022499984

View in Genome Browser
Species Human (GRCh38)
Location 7:30876767-30876789
Sequence CCCCCTGCAAAGATTCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022499979_1022499984 13 Left 1022499979 7:30876731-30876753 CCTGAGGGGCAGCAGGAGTGCTT No data
Right 1022499984 7:30876767-30876789 CCCCCTGCAAAGATTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022499984 Original CRISPR CCCCCTGCAAAGATTCTTGG AGG Intronic