ID: 1022499986

View in Genome Browser
Species Human (GRCh38)
Location 7:30876768-30876790
Sequence CCCCTGCAAAGATTCTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022499979_1022499986 14 Left 1022499979 7:30876731-30876753 CCTGAGGGGCAGCAGGAGTGCTT No data
Right 1022499986 7:30876768-30876790 CCCCTGCAAAGATTCTTGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022499986 Original CRISPR CCCCTGCAAAGATTCTTGGA GGG Intronic