ID: 1022499989 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:30876773-30876795 |
| Sequence | GCAAAGATTCTTGGAGGGTC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1022499979_1022499989 | 19 | Left | 1022499979 | 7:30876731-30876753 | CCTGAGGGGCAGCAGGAGTGCTT | No data | ||
| Right | 1022499989 | 7:30876773-30876795 | GCAAAGATTCTTGGAGGGTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1022499989 | Original CRISPR | GCAAAGATTCTTGGAGGGTC CGG | Intronic | ||