ID: 1022499990

View in Genome Browser
Species Human (GRCh38)
Location 7:30876779-30876801
Sequence ATTCTTGGAGGGTCCGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022499981_1022499990 -8 Left 1022499981 7:30876764-30876786 CCACCCCCTGCAAAGATTCTTGG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1022499990 7:30876779-30876801 ATTCTTGGAGGGTCCGGATGAGG No data
1022499979_1022499990 25 Left 1022499979 7:30876731-30876753 CCTGAGGGGCAGCAGGAGTGCTT No data
Right 1022499990 7:30876779-30876801 ATTCTTGGAGGGTCCGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022499990 Original CRISPR ATTCTTGGAGGGTCCGGATG AGG Intronic