ID: 1022500390

View in Genome Browser
Species Human (GRCh38)
Location 7:30878887-30878909
Sequence TCTGACCTGGTGAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022500390 Original CRISPR TCTGACCTGGTGAAAGTGGA TGG (reversed) Intronic
901050427 1:6423519-6423541 TCTGGCCTGGTGGAAGTCGTTGG + Intronic
902334508 1:15747365-15747387 CCTGGCCTGGTGAAAGAGGGTGG - Intronic
902736694 1:18405941-18405963 TCTGACCTGGGAAAAGGAGAAGG + Intergenic
903029031 1:20449425-20449447 TCTGAAGTGGTGATATTGGAAGG - Intergenic
903550631 1:24155536-24155558 GCTGCTCTGGTGAAAGTGGGAGG + Exonic
907252178 1:53146744-53146766 ACTGACCCAGTGAATGTGGAGGG - Intergenic
910245591 1:85135051-85135073 TGGGACCAGGTGACAGTGGAAGG - Intergenic
910264210 1:85321501-85321523 TCTGAACTGGAAAAGGTGGATGG - Exonic
910294029 1:85626877-85626899 TCTGCCCTGGTGAGGCTGGAAGG + Intergenic
910487408 1:87730807-87730829 AATGACCTGGTGAATGTGTATGG - Intergenic
910795450 1:91092934-91092956 TTTGACCTGGTTAACGTGGAGGG + Intergenic
912978612 1:114351110-114351132 TCGGACCATGTGAGAGTGGAGGG + Intergenic
914389013 1:147201430-147201452 TCTGGCTTGGTGAAAGTGAAAGG - Exonic
914901918 1:151715739-151715761 TCAGGCCTGAGGAAAGTGGATGG - Intronic
915076296 1:153310679-153310701 TCTGACCGGGAGAGTGTGGACGG + Exonic
917695870 1:177523376-177523398 TCTGGATTGGTGAAACTGGAGGG + Intergenic
918148721 1:181780433-181780455 CCTCTCCTGGTGCAAGTGGAGGG + Intronic
919788377 1:201274691-201274713 TATGACCTGGAAAGAGTGGAGGG + Intergenic
919872344 1:201831759-201831781 TCTGGCCTGATGAAACTGGCAGG + Intronic
919912612 1:202121135-202121157 TCTGGGCTGGTGAAGGTGGTAGG + Intergenic
922852836 1:228748431-228748453 GCTGACCTGGTGGAACTGTAGGG + Intergenic
923086332 1:230705984-230706006 TCTGACCTGGACAAGGTGGAGGG - Exonic
924827000 1:247550262-247550284 TTTAACCTGGTGAAAGGAGACGG - Intronic
1062917873 10:1255745-1255767 TGTGACCTCATGAGAGTGGAGGG + Intronic
1064493918 10:15887691-15887713 TATGAAGTGGTGAAAGTAGATGG - Intergenic
1065666710 10:28071026-28071048 CCTCACCTGGTGACACTGGAAGG + Intronic
1067060076 10:43073742-43073764 TCGGTCCTGGTGATACTGGAAGG - Intergenic
1067235440 10:44443415-44443437 TCAGACCAGTTGAAAGTGAAGGG + Intergenic
1071071152 10:81696031-81696053 TCTCACATGGTGAAAGGGGTAGG + Intergenic
1075575506 10:123574412-123574434 TCAGACCTGGGGAGAGGGGAGGG - Intergenic
1075736750 10:124669023-124669045 CCTGGCCTGGGGAAAGTGCAGGG + Intronic
1076843850 10:133059598-133059620 AATTACCTGGGGAAAGTGGAGGG + Intergenic
1077316779 11:1922860-1922882 TCAGACATGGTGAAGGTGGGTGG - Exonic
1080030800 11:27658571-27658593 TCTCACCTGGTGGAACTGTAGGG + Exonic
1080603244 11:33841502-33841524 TCTAACCAGGGGACAGTGGATGG + Intergenic
1080633642 11:34104683-34104705 TCTGACGGGGTGACACTGGATGG - Intergenic
1081615142 11:44586330-44586352 TGTGACCTCCTGAAACTGGAAGG + Intronic
1083658435 11:64241364-64241386 TCCGAGCTGGTGCCAGTGGAAGG + Intronic
1084758898 11:71256008-71256030 TCTGAGCTGATGAGAGGGGATGG + Intergenic
1086335280 11:85794518-85794540 TGTGACCTTGAGAAAGTGGGAGG - Intronic
1088210046 11:107444773-107444795 TCTGACTTGGTTTAAGTGGGTGG - Intronic
1090432067 11:126654436-126654458 TCTGAAATGTTGAAGGTGGAGGG + Intronic
1090613326 11:128491697-128491719 TCAGTCCTGGTGAGAGAGGATGG + Intronic
1090939072 11:131371964-131371986 TCTGACCCGGTGAAAAACGATGG + Intronic
1092238057 12:6822005-6822027 TCTGCCCTGGAGAACCTGGAGGG + Intronic
1093890335 12:24512384-24512406 TCTGTTCTGGTGACAATGGAAGG - Intergenic
1101252635 12:102950909-102950931 TCTGACCCGGTGAAAGGCAAAGG + Intronic
1101372319 12:104140605-104140627 GATGACTTGGTGAAAGAGGAAGG + Intergenic
1102041014 12:109800753-109800775 TCTGACCTGGGGGCAGGGGACGG + Exonic
1103965953 12:124639434-124639456 TCTGACCTGGGGAAACTCAATGG - Intergenic
1106288439 13:28338472-28338494 TCTGAGCTGGAGGAACTGGAAGG + Intronic
1107437346 13:40391735-40391757 TCTGAGGTGGAGAAAGTAGAGGG - Intergenic
1111350195 13:87018460-87018482 GTTGACCTGGATAAAGTGGATGG + Intergenic
1111479773 13:88809722-88809744 ACTGTCCTGGGGAAACTGGATGG + Intergenic
1111888749 13:94055198-94055220 TCAGCCCTGGTGAAAGTGTGAGG + Intronic
1113627116 13:111855518-111855540 TCTGCCCTGGTGAAAGGAGCAGG - Intergenic
1114529749 14:23388338-23388360 TCTGCCCAGGTGAGGGTGGAGGG + Exonic
1118624929 14:67649968-67649990 TTTGGCCTGGAGCAAGTGGAAGG - Exonic
1121371977 14:93367355-93367377 TGTGTCGTGGTAAAAGTGGATGG + Intronic
1122628498 14:103096873-103096895 TGTGATCAGGTGAAGGTGGATGG + Intergenic
1124596137 15:31092559-31092581 TCTGTCCTCCTGAAAGGGGAAGG - Intronic
1125330212 15:38574835-38574857 GCTTACCTGGTGAAAATAGATGG - Intergenic
1125457420 15:39874354-39874376 TTTGGTCTGGTGAAAATGGATGG - Intronic
1127849608 15:62901351-62901373 TCTGACCTGGTGACAGAGATGGG + Intergenic
1128936607 15:71751130-71751152 TTTAGCCTGGAGAAAGTGGAAGG - Intronic
1129714158 15:77837284-77837306 GCTTACCTGGTGGAGGTGGAGGG - Intergenic
1131774824 15:95783355-95783377 TCTGCCCTGGGGAAAGGGGCTGG + Intergenic
1132557936 16:580644-580666 TCTGACCTGGTGAGAGGGCCGGG + Intronic
1134231212 16:12432078-12432100 TAAGACCTGGTGATGGTGGAGGG + Intronic
1134846691 16:17446739-17446761 TCTGAACTGGTGAAAGTCTGGGG + Intronic
1136596738 16:31255817-31255839 CCTGACCTGGTGACCGTGGGTGG - Intergenic
1137943763 16:52714450-52714472 TCTGACCTGGAAAATGAGGAGGG - Intergenic
1138347626 16:56329757-56329779 TGAGACCTGGTGAAAATGGCTGG - Intronic
1138921767 16:61539086-61539108 TTTCACCTTGTGAAACTGGAGGG - Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1140750704 16:78021044-78021066 GCTGACCAGGTGCAAATGGAGGG - Intergenic
1141058361 16:80840113-80840135 TCTTACCTGGATAGAGTGGAGGG + Intergenic
1143001734 17:3798992-3799014 GCTGGCCTGGAGAGAGTGGAAGG + Intronic
1143374946 17:6461888-6461910 TCTGGCCTGGTGAAAGCGAAAGG - Intronic
1145241583 17:21243526-21243548 ACTGACCTGGGCAAAGTGGAAGG - Intronic
1147704249 17:42414985-42415007 CCTGGCCTGGTGACAGTGGGAGG - Intronic
1147721879 17:42544362-42544384 TCTGACCTGGGGGGATTGGAGGG + Exonic
1148330035 17:46808734-46808756 TGTGAACTGGTGAACATGGAGGG + Intronic
1150509712 17:65737673-65737695 TCTGACCTGAGGGAAGGGGAAGG - Intronic
1152930188 17:83105332-83105354 TCTGAACTGATGACAGTGGACGG + Intergenic
1165196857 19:34110911-34110933 TCTGACCTGGGGACTCTGGATGG - Intergenic
1167695163 19:51010814-51010836 TGTGAGCAGGAGAAAGTGGAAGG - Intergenic
924961056 2:35036-35058 TCTGACATGAAGTAAGTGGATGG - Intergenic
925707203 2:6698060-6698082 GCTGACCTGATGAGCGTGGAGGG - Intergenic
926422384 2:12712810-12712832 TCTCACGTGGTGGAAGTGGCAGG - Intergenic
926633694 2:15159224-15159246 TCTGAACTGGTGAACGCGCAGGG - Intergenic
926893923 2:17663142-17663164 TCTGAACTGGTCAAAGTAGAAGG + Intergenic
926895177 2:17679149-17679171 AATGAACTGGTGAAAGTGTAGGG - Intronic
928364401 2:30690302-30690324 TCCGACGTGGGGAATGTGGATGG - Intergenic
929000051 2:37338632-37338654 TCTGATCTGGTGAAAGAAGTTGG + Intergenic
931088710 2:58863168-58863190 TCTGACCTTGTGAAAGAGAGGGG - Intergenic
931464758 2:62476364-62476386 TCTTACCTGGTGGTAGTGGAAGG - Intergenic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
932804282 2:74769471-74769493 TTTAACCTGGTGAAAATGGGAGG - Intergenic
934942117 2:98510259-98510281 TCTTGCCTGGAGCAAGTGGAAGG + Intronic
934950913 2:98574853-98574875 TCTGTTCTGGTGACAGGGGATGG - Intronic
935301758 2:101698488-101698510 TTTGAGCTGGTGGAAGTGGTTGG + Exonic
936343847 2:111660254-111660276 TCTGAGCTGGAGAAAGTGTGCGG - Intergenic
936349907 2:111704628-111704650 TCTGGTTTGGTGAAAGGGGATGG + Intergenic
937028789 2:118720966-118720988 TCTGACCTAGAGATAGAGGAAGG - Intergenic
937306891 2:120877139-120877161 TCTGACCTGCTGGAGGAGGAGGG - Intronic
939568034 2:143807918-143807940 TCAGACCTTGTGAAAGGGGGTGG - Intergenic
939895367 2:147785017-147785039 TCTGACCAGTGGAATGTGGATGG - Intergenic
941934851 2:170974319-170974341 TCTTAGGTGGTCAAAGTGGAAGG + Intergenic
942292725 2:174487602-174487624 ACTGCCTTGGTGAAGGTGGAAGG - Intergenic
942737900 2:179137376-179137398 TCTAACCTGGAGAAAGAGTATGG + Intronic
944890129 2:204108918-204108940 ACTGACCTAGTGGAAGTGGGAGG + Intergenic
945059755 2:205898704-205898726 GCTCACGTGGTGAAAGAGGAAGG - Intergenic
945998919 2:216464431-216464453 TCTGACTTGGCCAAAGTGAAAGG + Intronic
946846106 2:223860276-223860298 TCTGACCTAGAGAAAATAGAAGG + Intronic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
948249463 2:236514033-236514055 TTTGCCCTTGGGAAAGTGGAAGG + Intergenic
948472994 2:238197456-238197478 TATGACCTGGTACAAGCGGAAGG - Intronic
1168820411 20:769085-769107 TCTGACATTTTGAAGGTGGAAGG + Intergenic
1169148598 20:3271212-3271234 TCTGAACTGGTGAAGGTAAATGG - Intronic
1169957955 20:11126823-11126845 TGTGAGAGGGTGAAAGTGGAAGG - Intergenic
1171849278 20:30296412-30296434 TCTGACCTTGAGAAAGTGAGAGG + Intergenic
1172154085 20:32811304-32811326 TCTGATCTGGGGAAAGAGGTTGG + Intergenic
1173273431 20:41557172-41557194 TCTGAACTGGGGAAACTGGTGGG + Intronic
1174414167 20:50356363-50356385 TGTGACCTGGGGCAGGTGGATGG + Intergenic
1175552719 20:59827550-59827572 TCTCACCTGGTGAGACTGAAAGG - Intronic
1175766691 20:61597456-61597478 TCTGTACTGGGGAAGGTGGAAGG - Intronic
1176927196 21:14764689-14764711 TCTCACATGGTGTGAGTGGAGGG - Intergenic
1179047235 21:37856824-37856846 TCTGACCTGGGGAAGTTGTATGG + Intronic
1179390005 21:40979766-40979788 TCTCACCTGGCAGAAGTGGAAGG - Intergenic
1180926282 22:19557305-19557327 ACTGACCTGATGAAGGTGGAGGG + Intergenic
1182857241 22:33528615-33528637 TCTGATCAGGTGAAAAAGGAGGG + Intronic
950112373 3:10427650-10427672 TCTGGGATGGTGAAGGTGGAGGG + Intronic
951948268 3:28167151-28167173 TCTGGCCAGTGGAAAGTGGATGG - Intergenic
954633897 3:52061206-52061228 GCAGACCTGGTGAGAGTGCAGGG + Intergenic
955984581 3:64559398-64559420 ACTGGGGTGGTGAAAGTGGACGG - Intronic
956240183 3:67121197-67121219 TCTGACCTTGTAAAATGGGAGGG - Intergenic
957155732 3:76541690-76541712 TCAGACCTGGTGTAAGTAGTTGG + Intronic
957163988 3:76647045-76647067 TCTGACCTTGAAAAAGGGGAGGG + Intronic
962983948 3:140517704-140517726 TCTGCTCTGGTGGAGGTGGAGGG + Intronic
964288959 3:155154197-155154219 TCTAATCTGGTGCAATTGGATGG + Intronic
967517998 3:190393163-190393185 TCTGATCTGGGGCAATTGGAGGG + Intronic
967615864 3:191565663-191565685 TCTGAACAGGTGTAAGTGGGTGG + Intergenic
968964780 4:3764365-3764387 TGTGACCTGGGGATGGTGGAGGG - Intergenic
970996143 4:22269225-22269247 CCTGTTCTGGTGAAGGTGGAAGG - Intergenic
971906770 4:32736270-32736292 TCAGGCCTGGTGTAAGTGTAAGG + Intergenic
971960085 4:33474676-33474698 TGGGACCTGGAGAAAGAGGATGG - Intergenic
976141307 4:81995222-81995244 TATTACCTGGTGAGAGGGGAAGG + Intronic
976385604 4:84454159-84454181 TCTAGCCTGGTGGATGTGGAAGG + Intergenic
976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG + Intergenic
978978759 4:114915356-114915378 TCCTACCTGGTGTAAGTGGGGGG - Intronic
980600184 4:135013434-135013456 ACTTCCCTGGTGAAAGTAGAAGG + Intergenic
984916460 4:184729655-184729677 TCTGACCTAGGGAAAGTGATGGG + Intronic
985332613 4:188856436-188856458 TCTGGCCTGGATAAAGAGGATGG + Intergenic
985684069 5:1272526-1272548 TCTGATGTGGTGACTGTGGATGG - Intronic
985684076 5:1272560-1272582 TCTGATGTGGTGACTGTGGATGG - Intronic
985684082 5:1272594-1272616 TCTGATGTGGTGACTGTGGATGG - Intronic
985684117 5:1272772-1272794 TCTGATGTGGTGACTGTGGATGG - Intronic
985684131 5:1272842-1272864 TCTGATGTGGTGACTGTGGATGG - Intronic
985684191 5:1273141-1273163 TCTGATGTGGTGACTGTGGATGG - Intronic
985684219 5:1273283-1273305 TCTGATGTGGTGACTGTGGATGG - Intronic
985684233 5:1273353-1273375 TCTGATGTGGTGACTGTGGATGG - Intronic
985684272 5:1273541-1273563 TCTGATGTGGTGACTGTGGATGG - Intronic
985684279 5:1273575-1273597 TCTGATGTGGTGACTGTGGATGG - Intronic
985684304 5:1273686-1273708 TCTGATGTGGTGACTGTGGATGG - Intronic
985684311 5:1273720-1273742 TCTGATGTGGTGACTGTGGATGG - Intronic
986188588 5:5470364-5470386 TCTGAACAGGTGAAAGGAGATGG - Intronic
986966694 5:13281418-13281440 TCTGACCTGGGTAATGTGGCAGG - Intergenic
987076342 5:14385626-14385648 TTGGAACTGGTGACAGTGGAAGG + Intronic
987761273 5:22165279-22165301 TCTGTCATGGAGAAAGTGAAGGG - Intronic
988577342 5:32440224-32440246 TCAGACATGGTGAAAATGTAAGG - Intronic
990865209 5:60372533-60372555 TCTGTCTTGGTGCAAGTGGGAGG - Intronic
990993615 5:61709194-61709216 TCTGGCCTGGTGAGAGTAGGAGG + Intronic
991543231 5:67752443-67752465 CCTGCCCTGGTGAAGGTGGCAGG - Intergenic
993227419 5:85184696-85184718 TCTGAAGGGGAGAAAGTGGAAGG - Intergenic
996371753 5:122760527-122760549 TTTGCCCTGGAGATAGTGGAAGG + Intergenic
996371926 5:122762610-122762632 TCTGAAAGGGTGAAAGGGGATGG - Intergenic
1000706476 5:164519425-164519447 TCTGAAGTGGTGATGGTGGAGGG + Intergenic
1002002553 5:176206265-176206287 TCTCACATGGTGAAAGCAGAAGG + Intergenic
1006185707 6:32180546-32180568 TCTGCCCTGGGGAAGGAGGATGG + Exonic
1007882654 6:45184917-45184939 TTTGGCCTGCTGAAAGTGGGTGG - Intronic
1009796829 6:68479986-68480008 TCTTACCTGGTGGAAGTGAAAGG - Intergenic
1010544688 6:77137848-77137870 ACTGACATGGGGAGAGTGGATGG - Intergenic
1016958976 6:149653528-149653550 TCTCACCTGGTGAAAAGAGAGGG - Intergenic
1019526885 7:1484474-1484496 TGTGACCTAGTGAAAGTTGGTGG - Intronic
1022500390 7:30878887-30878909 TCTGACCTGGTGAAAGTGGATGG - Intronic
1022998990 7:35788061-35788083 TCAGATATGGTGAAAGTTGAGGG - Intergenic
1025256316 7:57385849-57385871 TGTGACCTGGAGCAGGTGGAGGG - Intergenic
1026363924 7:69628614-69628636 ACTTACATGGTGAAAGTTGAAGG + Intronic
1027417598 7:77989946-77989968 TCTGTTCTGGTGGAAGTGGCAGG + Intergenic
1027975551 7:85149691-85149713 TCTGACATGGTGGAAGTGAATGG - Intronic
1029482699 7:100822784-100822806 TGTGCCCTGGGGAAGGTGGAGGG - Intronic
1029558280 7:101285546-101285568 TCTGACCTGGTCACACTGGTGGG + Intergenic
1031170438 7:118286248-118286270 TCTGACCTGGGGAAGGTTTAAGG - Intergenic
1032119981 7:129148652-129148674 TCTGACCTGGCTTAAGTGGAGGG - Intronic
1034419668 7:150982837-150982859 TCTGACCTGGTTCAAGTGTTGGG - Intergenic
1035925542 8:3724124-3724146 TCTGGCATGGTGAAAGAGGCTGG - Intronic
1036690713 8:10943091-10943113 TCTGACCTGGGCAGAGTGAATGG - Intronic
1037210943 8:16386990-16387012 TCTGACTTGGTCATAGTGTATGG + Intronic
1037737536 8:21579602-21579624 TCTGAGCTGGGGACATTGGAAGG - Intergenic
1039572706 8:38600419-38600441 TCTGCCCTGGGGAAGGAGGATGG - Intergenic
1041067309 8:54094374-54094396 TGTGAGCTGGTGCAACTGGAGGG + Intronic
1041117286 8:54552175-54552197 ACTGACCAGGTGAAAGTGAGCGG + Intergenic
1042453078 8:68972403-68972425 TGTGAGCTGATGAAAGTGTAAGG + Intergenic
1043733040 8:83708905-83708927 TTTGTACTGGTGAAAGGGGAAGG + Intergenic
1045655997 8:104387124-104387146 CCTGGCCTGGTGAATGTAGAGGG + Intronic
1046087224 8:109453197-109453219 TGTGATCTAGTGAAAGTGGGCGG - Intronic
1046386869 8:113517560-113517582 ACATTCCTGGTGAAAGTGGAAGG - Intergenic
1046908232 8:119597380-119597402 TCTAACCTGCTGCAATTGGAAGG - Intronic
1047334927 8:123926376-123926398 TCTGGCCTGGGGAAACTGCATGG - Intronic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1050076606 9:1872232-1872254 TCTGACCTGGAGAAAATGTCAGG + Intergenic
1052820088 9:33131429-33131451 TGTGACCTGCTGTAAGCGGAAGG + Intronic
1053706784 9:40762198-40762220 TCCGACCTGGTGACAGAGCAAGG + Intergenic
1054416698 9:64882968-64882990 TCCGACCTGGTGACAGAGCAAGG + Intergenic
1057713418 9:97467905-97467927 ACTGACCTGTTGGAAGTGGATGG + Intronic
1058566831 9:106294789-106294811 TCTGATCTAGTAGAAGTGGAAGG + Intergenic
1058750437 9:108033930-108033952 ACTGACCTGGTGTAGGAGGATGG - Intergenic
1060588588 9:124801952-124801974 TCTGACCAGGTGACAGGGAATGG + Intronic
1060887132 9:127162338-127162360 CCTGACATGGTACAAGTGGAAGG + Intronic
1061016702 9:127985198-127985220 TCACACCTGGAGAAAGTGGGAGG + Intergenic
1062271959 9:135713923-135713945 CCTCACCTGGTGACAGTGGCAGG + Intronic
1062401326 9:136373926-136373948 TGTGACCAGGTCAAAGTGGCTGG - Intergenic
1062711019 9:137975257-137975279 TGTGACTTGGTGACAGTGCAAGG + Intronic
1185822248 X:3216831-3216853 TCAGACCTGGAGAAGATGGAAGG + Intergenic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1187175707 X:16894626-16894648 TCTGATCAGGTGAAAGTTAATGG - Intergenic
1187369714 X:18694818-18694840 TCTGGCCTGGAGGAACTGGAGGG + Intronic
1189209080 X:39267553-39267575 TCAGACAAGGTGAAAGTGCAAGG - Intergenic
1189966134 X:46375739-46375761 CTTGTGCTGGTGAAAGTGGAGGG + Intergenic
1193404304 X:81082918-81082940 CCTGCTCTGGTGGAAGTGGAAGG - Intergenic
1194944590 X:100051919-100051941 TTTGACGAGGTGAAAGAGGAAGG + Intergenic
1196987630 X:121292458-121292480 TCTGCCCAAGTGAAAATGGATGG - Intergenic
1198089142 X:133310580-133310602 TCTGCTCTGGTGAGAGTGGAAGG - Intronic
1198692872 X:139303113-139303135 TCTGGCCTGGAGAAACTGGTGGG - Intergenic
1200061937 X:153487633-153487655 TCTGACCTGGTGCCAGGGAAGGG + Intronic
1200334638 X:155336651-155336673 TCTCACATGATGAAAGTGGGAGG + Intergenic
1200983459 Y:9283189-9283211 TCCCACCTGGTGAAGGTAGAAGG - Intergenic
1201928804 Y:19318928-19318950 TCTCAGCTTTTGAAAGTGGAGGG - Intergenic
1202126920 Y:21576498-21576520 TCCCACCTGGTGAAGGTAGAAGG + Intergenic