ID: 1022503004

View in Genome Browser
Species Human (GRCh38)
Location 7:30894276-30894298
Sequence TGCTGGCCTCCTCTTTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022502997_1022503004 29 Left 1022502997 7:30894224-30894246 CCTGCAGCAGTGCTGGGTGTTGC No data
Right 1022503004 7:30894276-30894298 TGCTGGCCTCCTCTTTTGTGAGG No data
1022503001_1022503004 0 Left 1022503001 7:30894253-30894275 CCCTCTGATGAGCACATAGGAAG No data
Right 1022503004 7:30894276-30894298 TGCTGGCCTCCTCTTTTGTGAGG No data
1022503002_1022503004 -1 Left 1022503002 7:30894254-30894276 CCTCTGATGAGCACATAGGAAGT No data
Right 1022503004 7:30894276-30894298 TGCTGGCCTCCTCTTTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022503004 Original CRISPR TGCTGGCCTCCTCTTTTGTG AGG Intergenic
No off target data available for this crispr