ID: 1022505392

View in Genome Browser
Species Human (GRCh38)
Location 7:30906226-30906248
Sequence TCCTCACTTGCAGAAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022505392_1022505394 -6 Left 1022505392 7:30906226-30906248 CCAGCTTTTTCTGCAAGTGAGGA No data
Right 1022505394 7:30906243-30906265 TGAGGAATGCCTGCCCTTTCGGG No data
1022505392_1022505397 3 Left 1022505392 7:30906226-30906248 CCAGCTTTTTCTGCAAGTGAGGA No data
Right 1022505397 7:30906252-30906274 CCTGCCCTTTCGGGCCAGCAGGG No data
1022505392_1022505406 29 Left 1022505392 7:30906226-30906248 CCAGCTTTTTCTGCAAGTGAGGA No data
Right 1022505406 7:30906278-30906300 CCTCACCCTCAGGGCAGGGCTGG No data
1022505392_1022505393 -7 Left 1022505392 7:30906226-30906248 CCAGCTTTTTCTGCAAGTGAGGA No data
Right 1022505393 7:30906242-30906264 GTGAGGAATGCCTGCCCTTTCGG No data
1022505392_1022505401 19 Left 1022505392 7:30906226-30906248 CCAGCTTTTTCTGCAAGTGAGGA No data
Right 1022505401 7:30906268-30906290 AGCAGGGATTCCTCACCCTCAGG No data
1022505392_1022505407 30 Left 1022505392 7:30906226-30906248 CCAGCTTTTTCTGCAAGTGAGGA No data
Right 1022505407 7:30906279-30906301 CTCACCCTCAGGGCAGGGCTGGG No data
1022505392_1022505404 25 Left 1022505392 7:30906226-30906248 CCAGCTTTTTCTGCAAGTGAGGA No data
Right 1022505404 7:30906274-30906296 GATTCCTCACCCTCAGGGCAGGG No data
1022505392_1022505395 2 Left 1022505392 7:30906226-30906248 CCAGCTTTTTCTGCAAGTGAGGA No data
Right 1022505395 7:30906251-30906273 GCCTGCCCTTTCGGGCCAGCAGG No data
1022505392_1022505403 24 Left 1022505392 7:30906226-30906248 CCAGCTTTTTCTGCAAGTGAGGA No data
Right 1022505403 7:30906273-30906295 GGATTCCTCACCCTCAGGGCAGG No data
1022505392_1022505402 20 Left 1022505392 7:30906226-30906248 CCAGCTTTTTCTGCAAGTGAGGA No data
Right 1022505402 7:30906269-30906291 GCAGGGATTCCTCACCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022505392 Original CRISPR TCCTCACTTGCAGAAAAAGC TGG (reversed) Intergenic
No off target data available for this crispr