ID: 1022505399

View in Genome Browser
Species Human (GRCh38)
Location 7:30906257-30906279
Sequence GGAATCCCTGCTGGCCCGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022505399_1022505406 -2 Left 1022505399 7:30906257-30906279 CCTTTCGGGCCAGCAGGGATTCC No data
Right 1022505406 7:30906278-30906300 CCTCACCCTCAGGGCAGGGCTGG No data
1022505399_1022505403 -7 Left 1022505399 7:30906257-30906279 CCTTTCGGGCCAGCAGGGATTCC No data
Right 1022505403 7:30906273-30906295 GGATTCCTCACCCTCAGGGCAGG No data
1022505399_1022505404 -6 Left 1022505399 7:30906257-30906279 CCTTTCGGGCCAGCAGGGATTCC No data
Right 1022505404 7:30906274-30906296 GATTCCTCACCCTCAGGGCAGGG No data
1022505399_1022505408 0 Left 1022505399 7:30906257-30906279 CCTTTCGGGCCAGCAGGGATTCC No data
Right 1022505408 7:30906280-30906302 TCACCCTCAGGGCAGGGCTGGGG No data
1022505399_1022505407 -1 Left 1022505399 7:30906257-30906279 CCTTTCGGGCCAGCAGGGATTCC No data
Right 1022505407 7:30906279-30906301 CTCACCCTCAGGGCAGGGCTGGG No data
1022505399_1022505411 25 Left 1022505399 7:30906257-30906279 CCTTTCGGGCCAGCAGGGATTCC No data
Right 1022505411 7:30906305-30906327 AATGTGAATTCACCCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022505399 Original CRISPR GGAATCCCTGCTGGCCCGAA AGG (reversed) Intergenic
No off target data available for this crispr