ID: 1022505400

View in Genome Browser
Species Human (GRCh38)
Location 7:30906266-30906288
Sequence TGAGGGTGAGGAATCCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022505400_1022505411 16 Left 1022505400 7:30906266-30906288 CCAGCAGGGATTCCTCACCCTCA No data
Right 1022505411 7:30906305-30906327 AATGTGAATTCACCCCTTCCTGG No data
1022505400_1022505407 -10 Left 1022505400 7:30906266-30906288 CCAGCAGGGATTCCTCACCCTCA No data
Right 1022505407 7:30906279-30906301 CTCACCCTCAGGGCAGGGCTGGG No data
1022505400_1022505408 -9 Left 1022505400 7:30906266-30906288 CCAGCAGGGATTCCTCACCCTCA No data
Right 1022505408 7:30906280-30906302 TCACCCTCAGGGCAGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022505400 Original CRISPR TGAGGGTGAGGAATCCCTGC TGG (reversed) Intergenic
No off target data available for this crispr