ID: 1022505402

View in Genome Browser
Species Human (GRCh38)
Location 7:30906269-30906291
Sequence GCAGGGATTCCTCACCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022505396_1022505402 -6 Left 1022505396 7:30906252-30906274 CCTGCCCTTTCGGGCCAGCAGGG No data
Right 1022505402 7:30906269-30906291 GCAGGGATTCCTCACCCTCAGGG No data
1022505392_1022505402 20 Left 1022505392 7:30906226-30906248 CCAGCTTTTTCTGCAAGTGAGGA No data
Right 1022505402 7:30906269-30906291 GCAGGGATTCCTCACCCTCAGGG No data
1022505387_1022505402 26 Left 1022505387 7:30906220-30906242 CCACCCCCAGCTTTTTCTGCAAG No data
Right 1022505402 7:30906269-30906291 GCAGGGATTCCTCACCCTCAGGG No data
1022505388_1022505402 23 Left 1022505388 7:30906223-30906245 CCCCCAGCTTTTTCTGCAAGTGA No data
Right 1022505402 7:30906269-30906291 GCAGGGATTCCTCACCCTCAGGG No data
1022505389_1022505402 22 Left 1022505389 7:30906224-30906246 CCCCAGCTTTTTCTGCAAGTGAG No data
Right 1022505402 7:30906269-30906291 GCAGGGATTCCTCACCCTCAGGG No data
1022505398_1022505402 -10 Left 1022505398 7:30906256-30906278 CCCTTTCGGGCCAGCAGGGATTC No data
Right 1022505402 7:30906269-30906291 GCAGGGATTCCTCACCCTCAGGG No data
1022505390_1022505402 21 Left 1022505390 7:30906225-30906247 CCCAGCTTTTTCTGCAAGTGAGG No data
Right 1022505402 7:30906269-30906291 GCAGGGATTCCTCACCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022505402 Original CRISPR GCAGGGATTCCTCACCCTCA GGG Intergenic
No off target data available for this crispr