ID: 1022505406

View in Genome Browser
Species Human (GRCh38)
Location 7:30906278-30906300
Sequence CCTCACCCTCAGGGCAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022505390_1022505406 30 Left 1022505390 7:30906225-30906247 CCCAGCTTTTTCTGCAAGTGAGG No data
Right 1022505406 7:30906278-30906300 CCTCACCCTCAGGGCAGGGCTGG No data
1022505399_1022505406 -2 Left 1022505399 7:30906257-30906279 CCTTTCGGGCCAGCAGGGATTCC No data
Right 1022505406 7:30906278-30906300 CCTCACCCTCAGGGCAGGGCTGG No data
1022505396_1022505406 3 Left 1022505396 7:30906252-30906274 CCTGCCCTTTCGGGCCAGCAGGG No data
Right 1022505406 7:30906278-30906300 CCTCACCCTCAGGGCAGGGCTGG No data
1022505392_1022505406 29 Left 1022505392 7:30906226-30906248 CCAGCTTTTTCTGCAAGTGAGGA No data
Right 1022505406 7:30906278-30906300 CCTCACCCTCAGGGCAGGGCTGG No data
1022505398_1022505406 -1 Left 1022505398 7:30906256-30906278 CCCTTTCGGGCCAGCAGGGATTC No data
Right 1022505406 7:30906278-30906300 CCTCACCCTCAGGGCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022505406 Original CRISPR CCTCACCCTCAGGGCAGGGC TGG Intergenic
No off target data available for this crispr