ID: 1022505407

View in Genome Browser
Species Human (GRCh38)
Location 7:30906279-30906301
Sequence CTCACCCTCAGGGCAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022505400_1022505407 -10 Left 1022505400 7:30906266-30906288 CCAGCAGGGATTCCTCACCCTCA No data
Right 1022505407 7:30906279-30906301 CTCACCCTCAGGGCAGGGCTGGG No data
1022505392_1022505407 30 Left 1022505392 7:30906226-30906248 CCAGCTTTTTCTGCAAGTGAGGA No data
Right 1022505407 7:30906279-30906301 CTCACCCTCAGGGCAGGGCTGGG No data
1022505396_1022505407 4 Left 1022505396 7:30906252-30906274 CCTGCCCTTTCGGGCCAGCAGGG No data
Right 1022505407 7:30906279-30906301 CTCACCCTCAGGGCAGGGCTGGG No data
1022505398_1022505407 0 Left 1022505398 7:30906256-30906278 CCCTTTCGGGCCAGCAGGGATTC No data
Right 1022505407 7:30906279-30906301 CTCACCCTCAGGGCAGGGCTGGG No data
1022505399_1022505407 -1 Left 1022505399 7:30906257-30906279 CCTTTCGGGCCAGCAGGGATTCC No data
Right 1022505407 7:30906279-30906301 CTCACCCTCAGGGCAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022505407 Original CRISPR CTCACCCTCAGGGCAGGGCT GGG Intergenic
No off target data available for this crispr