ID: 1022505411

View in Genome Browser
Species Human (GRCh38)
Location 7:30906305-30906327
Sequence AATGTGAATTCACCCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022505399_1022505411 25 Left 1022505399 7:30906257-30906279 CCTTTCGGGCCAGCAGGGATTCC No data
Right 1022505411 7:30906305-30906327 AATGTGAATTCACCCCTTCCTGG No data
1022505405_1022505411 4 Left 1022505405 7:30906278-30906300 CCTCACCCTCAGGGCAGGGCTGG No data
Right 1022505411 7:30906305-30906327 AATGTGAATTCACCCCTTCCTGG No data
1022505410_1022505411 -2 Left 1022505410 7:30906284-30906306 CCTCAGGGCAGGGCTGGGGAAAA No data
Right 1022505411 7:30906305-30906327 AATGTGAATTCACCCCTTCCTGG No data
1022505409_1022505411 -1 Left 1022505409 7:30906283-30906305 CCCTCAGGGCAGGGCTGGGGAAA No data
Right 1022505411 7:30906305-30906327 AATGTGAATTCACCCCTTCCTGG No data
1022505400_1022505411 16 Left 1022505400 7:30906266-30906288 CCAGCAGGGATTCCTCACCCTCA No data
Right 1022505411 7:30906305-30906327 AATGTGAATTCACCCCTTCCTGG No data
1022505396_1022505411 30 Left 1022505396 7:30906252-30906274 CCTGCCCTTTCGGGCCAGCAGGG No data
Right 1022505411 7:30906305-30906327 AATGTGAATTCACCCCTTCCTGG No data
1022505398_1022505411 26 Left 1022505398 7:30906256-30906278 CCCTTTCGGGCCAGCAGGGATTC No data
Right 1022505411 7:30906305-30906327 AATGTGAATTCACCCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022505411 Original CRISPR AATGTGAATTCACCCCTTCC TGG Intergenic
No off target data available for this crispr