ID: 1022505574

View in Genome Browser
Species Human (GRCh38)
Location 7:30907122-30907144
Sequence TACCCCAGGCTGGCCGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022505574_1022505586 19 Left 1022505574 7:30907122-30907144 CCAGGCACGGCCAGCCTGGGGTA No data
Right 1022505586 7:30907164-30907186 TAGAGCAGGAAGGTATGGTGAGG No data
1022505574_1022505583 9 Left 1022505574 7:30907122-30907144 CCAGGCACGGCCAGCCTGGGGTA No data
Right 1022505583 7:30907154-30907176 GGCCTCTGTCTAGAGCAGGAAGG No data
1022505574_1022505587 30 Left 1022505574 7:30907122-30907144 CCAGGCACGGCCAGCCTGGGGTA No data
Right 1022505587 7:30907175-30907197 GGTATGGTGAGGACCTCAAAAGG No data
1022505574_1022505585 14 Left 1022505574 7:30907122-30907144 CCAGGCACGGCCAGCCTGGGGTA No data
Right 1022505585 7:30907159-30907181 CTGTCTAGAGCAGGAAGGTATGG No data
1022505574_1022505582 5 Left 1022505574 7:30907122-30907144 CCAGGCACGGCCAGCCTGGGGTA No data
Right 1022505582 7:30907150-30907172 CCGGGGCCTCTGTCTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022505574 Original CRISPR TACCCCAGGCTGGCCGTGCC TGG (reversed) Intergenic
No off target data available for this crispr