ID: 1022510819

View in Genome Browser
Species Human (GRCh38)
Location 7:30933819-30933841
Sequence TGCCCTGCAGGGGTCCCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022510819_1022510830 13 Left 1022510819 7:30933819-30933841 CCTTCGGGGACCCCTGCAGGGCA No data
Right 1022510830 7:30933855-30933877 AATGCATTGAGGAGGGAGTTAGG No data
1022510819_1022510833 29 Left 1022510819 7:30933819-30933841 CCTTCGGGGACCCCTGCAGGGCA No data
Right 1022510833 7:30933871-30933893 AGTTAGGCTCCTTAGCAGGTGGG No data
1022510819_1022510834 30 Left 1022510819 7:30933819-30933841 CCTTCGGGGACCCCTGCAGGGCA No data
Right 1022510834 7:30933872-30933894 GTTAGGCTCCTTAGCAGGTGGGG No data
1022510819_1022510831 25 Left 1022510819 7:30933819-30933841 CCTTCGGGGACCCCTGCAGGGCA No data
Right 1022510831 7:30933867-30933889 AGGGAGTTAGGCTCCTTAGCAGG No data
1022510819_1022510829 6 Left 1022510819 7:30933819-30933841 CCTTCGGGGACCCCTGCAGGGCA No data
Right 1022510829 7:30933848-30933870 GGGGCTTAATGCATTGAGGAGGG No data
1022510819_1022510832 28 Left 1022510819 7:30933819-30933841 CCTTCGGGGACCCCTGCAGGGCA No data
Right 1022510832 7:30933870-30933892 GAGTTAGGCTCCTTAGCAGGTGG No data
1022510819_1022510827 2 Left 1022510819 7:30933819-30933841 CCTTCGGGGACCCCTGCAGGGCA No data
Right 1022510827 7:30933844-30933866 TTCTGGGGCTTAATGCATTGAGG No data
1022510819_1022510828 5 Left 1022510819 7:30933819-30933841 CCTTCGGGGACCCCTGCAGGGCA No data
Right 1022510828 7:30933847-30933869 TGGGGCTTAATGCATTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022510819 Original CRISPR TGCCCTGCAGGGGTCCCCGA AGG (reversed) Intergenic
No off target data available for this crispr