ID: 1022514722

View in Genome Browser
Species Human (GRCh38)
Location 7:30968314-30968336
Sequence GGAGAATGACACAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 943
Summary {0: 1, 1: 1, 2: 12, 3: 98, 4: 831}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022514712_1022514722 23 Left 1022514712 7:30968268-30968290 CCATTATTATGCAGAACTGCTTC 0: 1
1: 0
2: 0
3: 16
4: 143
Right 1022514722 7:30968314-30968336 GGAGAATGACACAGGGAAGGAGG 0: 1
1: 1
2: 12
3: 98
4: 831
1022514717_1022514722 1 Left 1022514717 7:30968290-30968312 CCAGGGAGCAGGAGTGGAGAGCA 0: 1
1: 0
2: 4
3: 56
4: 434
Right 1022514722 7:30968314-30968336 GGAGAATGACACAGGGAAGGAGG 0: 1
1: 1
2: 12
3: 98
4: 831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022514722 Original CRISPR GGAGAATGACACAGGGAAGG AGG Intronic
900311158 1:2033748-2033770 GCAGAATGACTCAGAGACGGAGG - Intergenic
900370694 1:2330845-2330867 GGAGAATTCCACAGGAACGGTGG - Intronic
900939223 1:5787037-5787059 AGAGAAGGAAAGAGGGAAGGAGG + Intergenic
901316287 1:8311772-8311794 AGAGAGTGAGACAGGGAAGAGGG - Intergenic
901440505 1:9275226-9275248 AGAGAAGGACACAGAGAAGAAGG - Intergenic
902494001 1:16856821-16856843 GGAGAATGAACTAGGGAAGCAGG + Intronic
903004229 1:20288081-20288103 GGAGACACACACAGGGAAGACGG + Intergenic
903010115 1:20323808-20323830 GGAGCAGGGCACAGGGAAGAGGG + Intronic
903025528 1:20427516-20427538 GGAGGAAGAGGCAGGGAAGGCGG - Intergenic
903299793 1:22370638-22370660 GGAGAATGAAGCAGGTGAGGAGG + Intergenic
903389951 1:22956598-22956620 TGTGATTGACACAGGTAAGGGGG - Intronic
903709841 1:25315367-25315389 GGAGCTTGCCACACGGAAGGGGG + Intronic
903717275 1:25377030-25377052 GGAGCTTGCCACACGGAAGGGGG - Intronic
903926634 1:26835126-26835148 AGAGAGTGGCAGAGGGAAGGAGG + Intronic
904183911 1:28687728-28687750 GGAGATAGAGACAGGGAGGGAGG + Intronic
904248588 1:29205880-29205902 GGAGAGTGAGACAGAGATGGAGG - Intronic
904281527 1:29423909-29423931 GGAGAAAAGCACAGGGAAGGGGG - Intergenic
904393063 1:30198355-30198377 AGAGAAAGACAGAGGGGAGGAGG + Intergenic
904864867 1:33570489-33570511 GGAGTTTGAAACTGGGAAGGAGG - Intronic
905357699 1:37396309-37396331 GGAGGGTGACACAGGGGTGGAGG - Intergenic
905362324 1:37429645-37429667 GGAGAAAGAGAGAGGGAAGGGGG - Intergenic
905362330 1:37429666-37429688 GGAGAAAGAGAGAGGAAAGGGGG - Intergenic
905464773 1:38144609-38144631 GGAGAAAGACACAGGCTGGGAGG - Intergenic
905819324 1:40977823-40977845 GGAGGCTGACACAGGGTGGGAGG - Intergenic
906189241 1:43885366-43885388 TGAGAAGGACCCGGGGAAGGAGG - Intronic
906518455 1:46453234-46453256 GGAGAGAGAGGCAGGGAAGGAGG + Intergenic
906532310 1:46530811-46530833 GTAGAATGGATCAGGGAAGGCGG - Intergenic
906917322 1:50024726-50024748 AGAGAGTGAAAGAGGGAAGGGGG + Intergenic
906926441 1:50122731-50122753 GGAGAATGATAAATGGAAGGTGG + Intronic
906952143 1:50343667-50343689 GCAGAATTACACAGGGACTGCGG + Intergenic
907315571 1:53568715-53568737 GGAGCAGGAGACAGAGAAGGGGG - Intronic
907333380 1:53685657-53685679 GGAGACAGTCACAGGCAAGGAGG - Intronic
907547488 1:55274873-55274895 GGAGGCTGACTCTGGGAAGGTGG + Intergenic
907728503 1:57043454-57043476 AGAGAATGCCACAGAGAAGAGGG - Intronic
907900220 1:58734435-58734457 GGAGCAAGAGAGAGGGAAGGGGG + Intergenic
908276904 1:62482767-62482789 GGAAAACAACATAGGGAAGGAGG - Intronic
908741671 1:67335229-67335251 AATTAATGACACAGGGAAGGTGG + Intronic
909389327 1:75100609-75100631 GGAGAAAGACAGAGGGAAGCTGG - Intergenic
909591908 1:77360011-77360033 GAAGAATAACACAGGAAAAGAGG + Intronic
909614471 1:77591321-77591343 GGAGAAGGAGAGAGGGAGGGAGG - Intronic
909741798 1:79038088-79038110 GGAGAAAGAGACAGGGGAGGAGG - Intergenic
909805770 1:79872779-79872801 GGAGAATGAGAGAGTGAAGGGGG - Intergenic
910084417 1:83382347-83382369 GGAGAATCTCACAGGCAAGGGGG + Intergenic
910694734 1:90000027-90000049 GGAGAGTAACATAGAGAAGGAGG + Intronic
910724594 1:90325240-90325262 GGAGAATGACAACTGGAAGTTGG - Intergenic
911234999 1:95403115-95403137 GGAGAAAGAAAAAGTGAAGGGGG - Intergenic
911701148 1:100953088-100953110 AGAGAAAGAGACAGTGAAGGAGG - Intronic
912299905 1:108504132-108504154 AGAGAATGACAAGGAGAAGGTGG - Intergenic
912509220 1:110176870-110176892 GGAGAGATGCACAGGGAAGGGGG + Intronic
912635493 1:111288507-111288529 GGGGAGTGAAACAGGGAAGAAGG - Intergenic
912772037 1:112473008-112473030 GGAGAGAGAGAGAGGGAAGGAGG + Intronic
913202815 1:116509667-116509689 GAAGAATAAAACAGGGAAGGGGG - Intergenic
913318075 1:117569064-117569086 TGAGGAGGACACAGGGAACGGGG - Intergenic
913582744 1:120243079-120243101 AGAGAAAGAGTCAGGGAAGGAGG - Intergenic
913625429 1:120655281-120655303 AGAGAAAGAGTCAGGGAAGGAGG + Intergenic
914564674 1:148854573-148854595 AGAGAAAGAGTCAGGGAAGGAGG - Intronic
914608152 1:149275669-149275691 AGAGAAAGAGTCAGGGAAGGAGG + Intergenic
914703741 1:150155069-150155091 GGAGAATGTCACTAGGAATGCGG + Intronic
914815218 1:151058130-151058152 GGAGAAGGAGAGAGGGAAAGGGG + Exonic
914828998 1:151157069-151157091 GGAGACTGAAACAGGGAGAGAGG + Intronic
914885972 1:151584675-151584697 GGGGCATGACACAGGGGAGCGGG + Intergenic
914965064 1:152249195-152249217 GGAGAATGGGATAGGGATGGGGG + Intergenic
915191845 1:154157485-154157507 CGAAAAAGACACAGGGAAGGAGG + Intronic
915418013 1:155757328-155757350 GGAGAGTCACAGAGGGAAAGAGG + Intronic
915489042 1:156241432-156241454 TGCTAAGGACACAGGGAAGGGGG + Intronic
915526317 1:156478463-156478485 AGACAATGGCACAGGGTAGGAGG + Intronic
915707781 1:157862848-157862870 GGCCAATGACTCAGGTAAGGGGG + Intronic
916028237 1:160854002-160854024 GCAGAAAGGAACAGGGAAGGTGG + Intronic
916288022 1:163132345-163132367 GCAGAATGCAACAGTGAAGGAGG + Intronic
916291826 1:163175279-163175301 AGAGACTGACAGAGGGAAGAGGG + Intronic
918202409 1:182279792-182279814 GGAGAGTGGGAGAGGGAAGGAGG - Intergenic
918358548 1:183730717-183730739 TGGCAATGAAACAGGGAAGGAGG + Intronic
920106148 1:203555099-203555121 TGAGAAGGGTACAGGGAAGGTGG + Intergenic
920188267 1:204175971-204175993 GGAGAAGGAAGGAGGGAAGGAGG - Intergenic
920266378 1:204726551-204726573 GAAGAATGACAGAGGGCAGGGGG - Intergenic
920398190 1:205661294-205661316 GGGGAAGGAGAAAGGGAAGGAGG + Intronic
920540590 1:206774870-206774892 GGAGAGTGACTCAGGGATGCAGG + Intergenic
920748078 1:208647754-208647776 GGAAAATTACACAGGGCAAGAGG - Intergenic
920764404 1:208817989-208818011 GGATATTGACACAGGGAAACAGG - Intergenic
920965132 1:210694979-210695001 TGAGAATGAGAAAGGGAAGGGGG + Intronic
920991690 1:210945880-210945902 GAAAAATGAAACAGGGAAGGGGG - Intronic
921157680 1:212450919-212450941 GAAGAATGAAACTGGGAAGGAGG - Intergenic
921387517 1:214585977-214585999 GGAGAGTGAGACAGGGAAGAAGG + Intergenic
921887503 1:220321536-220321558 GGAGAGAGACATAAGGAAGGAGG + Intergenic
922434525 1:225590682-225590704 GGAGACTGACATAGGGATGTTGG - Intronic
922565797 1:226600912-226600934 GGCGAATGACAGAGGAAAGGAGG - Intronic
922588306 1:226752614-226752636 GGACATTGACACAGAGAAGCAGG - Intergenic
922738841 1:228004678-228004700 GGAGGCTCACAGAGGGAAGGAGG + Intergenic
923125767 1:231033230-231033252 GGAGAATGACACTGGCAACGGGG + Intronic
923128821 1:231057189-231057211 GGAGAGAGACACAGTGAGGGGGG + Intergenic
923333534 1:232947300-232947322 GGATAATGAGAAAGGGAGGGAGG + Intergenic
923977311 1:239277818-239277840 GGTGAATGAGACAGAGAAGCTGG + Intergenic
924418226 1:243882050-243882072 TGACAAGGACACAGGGAAGATGG - Intergenic
924453157 1:244197695-244197717 GGAGAATGATACTGGAAAGCTGG + Intergenic
924615572 1:245609158-245609180 GAAGAAAGGCACAGGGAAGGGGG - Intronic
1062881115 10:979172-979194 GGAGAAGGAGCAAGGGAAGGAGG - Intergenic
1063000094 10:1909178-1909200 GGAAAATAACAGAGGGAAAGTGG + Intergenic
1063609399 10:7550287-7550309 TGAGCAGGACACAGGGAAGACGG - Intergenic
1063800271 10:9569033-9569055 GGGGAAAGAAAGAGGGAAGGAGG - Intergenic
1064133750 10:12732624-12732646 GGAGAATAGCACAGGAAAGATGG + Intronic
1064285159 10:13985334-13985356 GGACCATGGGACAGGGAAGGAGG + Intronic
1065305987 10:24369398-24369420 GGAGAAGGCCACAGGGAACTGGG - Intronic
1065308420 10:24390558-24390580 GGAGAAAGAGAGAGGGAGGGAGG + Intronic
1066579137 10:36861002-36861024 AGCAAGTGACACAGGGAAGGTGG - Intergenic
1067078401 10:43200867-43200889 GGAGAATGGCACAGTGAAGAAGG - Exonic
1067248884 10:44570713-44570735 GGAGCAAGAGACAGAGAAGGGGG + Intergenic
1067460295 10:46453227-46453249 GGGGAAGGAGACAGGGAAGGAGG - Intergenic
1067525822 10:47038010-47038032 GGAGAATGGCTGAAGGAAGGAGG + Intergenic
1067626895 10:47931376-47931398 GGGGAAGGAGACAGGGAAGGAGG + Intergenic
1068742296 10:60487530-60487552 TGAGAATCACATAGGGATGGTGG + Intronic
1069097549 10:64277963-64277985 AGAGAAAGACCCAGAGAAGGCGG - Intergenic
1069624725 10:69860703-69860725 GCAGAAGGCCACAGGCAAGGAGG - Intronic
1069742824 10:70696337-70696359 GGAGTATGAGACTGGGCAGGGGG + Intronic
1070574871 10:77670367-77670389 AGAGAATGAGAGAGGAAAGGGGG + Intergenic
1070624944 10:78044345-78044367 AGAGGATGACACTGGGGAGGTGG + Intronic
1070661532 10:78310019-78310041 GGAGAAGGAGAAAGAGAAGGAGG - Intergenic
1070782376 10:79145201-79145223 GGAGAAAGACACAGAAAGGGAGG - Intronic
1071053961 10:81487182-81487204 GGAGAAAGAAAGAGAGAAGGGGG + Intergenic
1071482386 10:86074871-86074893 TATGAATGATACAGGGAAGGAGG + Intronic
1071797810 10:89025028-89025050 CTGGAATGACACAGGGATGGGGG - Intergenic
1072257659 10:93635752-93635774 AGAGAGAGAGACAGGGAAGGAGG + Intronic
1072476711 10:95768442-95768464 AGAGAAAGAAAGAGGGAAGGAGG - Intronic
1072515602 10:96179809-96179831 GGAGAAGGAGAAAGAGAAGGAGG - Intronic
1072631864 10:97151881-97151903 GGAGAGTGAGGCAGTGAAGGAGG + Intronic
1072677263 10:97477214-97477236 AGAGAATGATAAAGGGAAAGAGG - Intronic
1073081432 10:100863375-100863397 GACGAGTGACAGAGGGAAGGAGG + Intergenic
1073082047 10:100866551-100866573 GGAGAAAGACAAAGAGAAGACGG + Intergenic
1073593633 10:104779368-104779390 GCAGAGTGACACAAGGAAGTTGG + Intronic
1073766134 10:106684928-106684950 GGAAAATGACAAAGGGAAGCAGG - Intronic
1073841365 10:107502701-107502723 GGAAAGTGAAACAAGGAAGGAGG + Intergenic
1074147732 10:110731320-110731342 AGAGAATGAAACAAGGAAGATGG + Intronic
1074275711 10:111999965-111999987 GGAGAATGAAACAGGGAAGAAGG + Intergenic
1074724134 10:116289936-116289958 AGAGAAGGAGACAGGGAAGCAGG - Intergenic
1074737936 10:116455324-116455346 GGATACAGACACAGGCAAGGTGG + Intronic
1074927169 10:118085107-118085129 GCAGAATGCAACAGTGAAGGAGG - Intergenic
1075122671 10:119675805-119675827 GGGGAAGGAAGCAGGGAAGGGGG - Intronic
1075162279 10:120034732-120034754 GGAGAGAGACAGAGGGAAGAAGG + Intergenic
1075356467 10:121781554-121781576 GGAGAATAAACCAGGGAAGGAGG - Intronic
1075452521 10:122561837-122561859 GGAGAGAGAAACAGAGAAGGAGG - Intronic
1075552508 10:123402445-123402467 AGGGAAGGAAACAGGGAAGGGGG + Intergenic
1075924281 10:126237577-126237599 GTAGAAAGAAAAAGGGAAGGAGG - Intronic
1076138932 10:128064404-128064426 GAAGAGTGACAGAGGGAAGTAGG + Intronic
1077480258 11:2811241-2811263 GGACAATGAGCCAGGGAAGCCGG - Intronic
1077865137 11:6215862-6215884 GGAGAATGATGGAGGGCAGGAGG + Intronic
1078467202 11:11559255-11559277 GGAGAATGTGACAGTGGAGGGGG - Intronic
1078593353 11:12665142-12665164 GGAGAAGGAGAAAGAGAAGGAGG + Intergenic
1078837123 11:15041698-15041720 GGAGAAAAACACAGGGCAGAGGG - Intronic
1079387795 11:19996375-19996397 GGAAAATGATACCTGGAAGGCGG - Intronic
1079834156 11:25310376-25310398 GGAGAAAGAAAGAGGGAGGGAGG + Intergenic
1079915996 11:26369400-26369422 GGAGAATGAGTAGGGGAAGGAGG - Intronic
1079975908 11:27091275-27091297 GGAGAATTTGACATGGAAGGTGG - Intronic
1080122016 11:28689351-28689373 AGAGAGAGAGACAGGGAAGGAGG + Intergenic
1080237794 11:30092327-30092349 GGAGAGAGAAAGAGGGAAGGAGG - Intergenic
1080471793 11:32552932-32552954 GGAGAATGCAGCAGGGAACGAGG + Intergenic
1080694810 11:34594090-34594112 GGAGAATGGCAGAGGGGAGACGG - Intergenic
1081050652 11:38336687-38336709 GGAGAATGAGAGAGCAAAGGAGG + Intergenic
1081093274 11:38899838-38899860 GGAGAAGGAGAAGGGGAAGGAGG + Intergenic
1081640913 11:44753573-44753595 GGAGAAAGAGACAGGGAAATTGG - Intronic
1081763874 11:45595758-45595780 GGAGAATAAGACAGGGCAGGAGG - Intergenic
1082711631 11:56560127-56560149 GGAGAAAAACAGAGCGAAGGGGG - Intergenic
1083010810 11:59397208-59397230 GGAGAAAAAGACAGTGAAGGAGG - Intergenic
1083064611 11:59912045-59912067 GGGGAGGGACACAGGGAAAGGGG - Intergenic
1083065644 11:59921421-59921443 GGAGAAAGAAAGAGTGAAGGGGG + Intergenic
1083619531 11:64042065-64042087 GGAGCTGGCCACAGGGAAGGTGG + Intronic
1083661834 11:64255020-64255042 GCAGGATGACACAGCCAAGGTGG + Exonic
1083822683 11:65181868-65181890 GGAGAAGGAGAGAGGGAGGGCGG + Intronic
1083854239 11:65384584-65384606 TGAGAATGACACAGGAAACAGGG + Intergenic
1084021530 11:66420842-66420864 GTAGAATGAGAGAGGGAGGGAGG - Intergenic
1084203278 11:67576457-67576479 GGAGAGTGGGACAGGGCAGGAGG - Intergenic
1084485275 11:69444364-69444386 AGAGGAGGACACAGGCAAGGCGG - Intergenic
1084518264 11:69647966-69647988 GCAGAAGGAGAGAGGGAAGGAGG - Intronic
1085143614 11:74171850-74171872 GGAGAATCGGCCAGGGAAGGTGG + Intronic
1085270095 11:75265147-75265169 GGAGAATGGCAGGGGGAAGCAGG + Exonic
1085643859 11:78210012-78210034 GGAGAAGGAGACAGAAAAGGAGG + Exonic
1085829686 11:79886102-79886124 GGAGAATGAGACCTGGAATGGGG + Intergenic
1086003164 11:82003755-82003777 GGTGAATGACACAGCTATGGAGG - Intergenic
1086377670 11:86217684-86217706 TGTGAATGACATAGGGAAGAAGG - Intergenic
1086956314 11:92937808-92937830 ACAGAATGACAGAGGGTAGGTGG + Intergenic
1087330118 11:96770735-96770757 GGAAAATGACACAAGAAATGGGG - Intergenic
1088105656 11:106204080-106204102 GGAGAATAAGGCAGGAAAGGAGG + Intergenic
1088509942 11:110564155-110564177 GGAGTAAGAAACAGGGAAGCAGG - Intergenic
1089028604 11:115298372-115298394 GGAGAAGAAGAAAGGGAAGGAGG + Intronic
1089255092 11:117189954-117189976 GGTGAATGTCACAGGGAATCAGG + Exonic
1090146794 11:124333113-124333135 AGAGAAGGACAAAGAGAAGGTGG + Intergenic
1090398730 11:126435229-126435251 TGAGAATGGCCCTGGGAAGGGGG - Intronic
1090621035 11:128561337-128561359 GGAGGCTGACACAGGTCAGGAGG + Intronic
1090973316 11:131661000-131661022 GGAAAAAGAAACGGGGAAGGTGG + Intronic
1091109161 11:132949404-132949426 GGAGAAAGACAAAGGGGAGGTGG + Intronic
1091255472 11:134181091-134181113 GGAGAATGGAACAGGGAATATGG - Exonic
1091468743 12:708590-708612 GAAGAATGAAACAGGAAAGGAGG - Intergenic
1091771804 12:3156878-3156900 GGAGAAGGGCCCAGGGCAGGGGG + Intronic
1092023707 12:5223325-5223347 GGATAGTGAAACAGGAAAGGAGG - Intergenic
1092065879 12:5589341-5589363 GGAGAGGGAGACAGGGAAGGAGG + Intronic
1092472452 12:8791562-8791584 GGAGATTAACACTGAGAAGGCGG - Intergenic
1092897219 12:13023808-13023830 GAAGAATGAAGCAGGAAAGGAGG + Intergenic
1093017650 12:14170975-14170997 GGAGAAGGGTAAAGGGAAGGGGG + Intergenic
1093095553 12:14967880-14967902 GGAGAAGGAGAAAGAGAAGGAGG - Intergenic
1093207680 12:16270016-16270038 GGATAATGACACAAGGATGTTGG + Intronic
1093439387 12:19176208-19176230 GGAGGAAGACAGAGGGAGGGAGG - Intronic
1093551608 12:20419218-20419240 GGAGAGTTACACACTGAAGGTGG + Intronic
1093925133 12:24902428-24902450 AGATAAAGACACAGGGAAGCGGG + Intronic
1094125336 12:27017204-27017226 GAAGAAAGAAACAGGAAAGGTGG + Intergenic
1094171262 12:27494817-27494839 GCAGAAGGCCAAAGGGAAGGAGG - Intronic
1094192469 12:27711197-27711219 GGAGCAGGTCACGGGGAAGGGGG - Intronic
1094559053 12:31532600-31532622 GGAGAATGATAGAGAGAAGCAGG + Intronic
1095177164 12:39106223-39106245 GGAGAAAGAGAGAGTGAAGGGGG + Intergenic
1095190990 12:39257576-39257598 GGAGAATAGCAAAGTGAAGGGGG + Intergenic
1095734922 12:45546457-45546479 GCTCAATGACAGAGGGAAGGAGG - Intergenic
1096059248 12:48682428-48682450 GGAGAGTGAGCCGGGGAAGGGGG + Intergenic
1096403365 12:51325000-51325022 GGAGATAGAAACAGGGTAGGGGG + Intergenic
1096445115 12:51682834-51682856 GGAGAATAAAATAGGGAAGAGGG - Intronic
1096628230 12:52908026-52908048 GGAGAGTGAACCAGGGAAGGAGG + Intronic
1096790498 12:54041566-54041588 GGACAATGCCACAGGCCAGGTGG + Intronic
1097125340 12:56770139-56770161 GGAGAGAGACAGAGGGAAGAGGG + Intronic
1097125401 12:56770526-56770548 GGAGAATGAGCCAGAGAAGTAGG - Intronic
1097348486 12:58521571-58521593 TGAGCATGAAACGGGGAAGGTGG + Intergenic
1097747313 12:63315464-63315486 GGAGAAAGAGAGAGAGAAGGAGG - Intergenic
1098145862 12:67497418-67497440 GGAGAGTGAAACAGGGAAGGAGG + Intergenic
1098841495 12:75483512-75483534 AGGGAATGAGCCAGGGAAGGAGG + Intronic
1099224177 12:79949407-79949429 GAAGGAGGACAGAGGGAAGGAGG - Intergenic
1099501866 12:83423137-83423159 GGACACAGACACAGGGAAGAGGG + Intergenic
1099876954 12:88419437-88419459 AGAAAATGAAGCAGGGAAGGGGG - Intergenic
1100129908 12:91479512-91479534 GGAGATTGACAGAGGGATGTCGG - Intergenic
1100433942 12:94554495-94554517 GGAGGAGGACACAGGGGAGGGGG + Intergenic
1100594768 12:96062424-96062446 TGAGAATAACAGTGGGAAGGTGG - Intergenic
1100900597 12:99236446-99236468 GGAGAGAGACACAGTAAAGGGGG + Intronic
1101404037 12:104412583-104412605 GGAGAAAGGCAGAGCGAAGGCGG - Intergenic
1101592430 12:106136728-106136750 GAAGAATCGCACTGGGAAGGTGG - Intronic
1102046091 12:109831337-109831359 GGAGAATGCCGTAGGGTAGGAGG - Intronic
1102409243 12:112702915-112702937 AGGGAATGTTACAGGGAAGGGGG - Intronic
1102495102 12:113314260-113314282 GGAGAAATTCACAGGGAATGTGG + Intronic
1102560455 12:113758370-113758392 GGAGAGTAAGTCAGGGAAGGAGG + Intergenic
1102610274 12:114105794-114105816 GGTCAATGGCCCAGGGAAGGGGG - Intergenic
1102708447 12:114903519-114903541 AGAGAAGGACAAAGGGAGGGAGG - Intergenic
1102959672 12:117084608-117084630 GGAGAGCCACACAGGGTAGGGGG + Intronic
1103358784 12:120341834-120341856 GGAGAGGGACACACAGAAGGGGG + Exonic
1103652447 12:122443472-122443494 GAAGAAAGAAAGAGGGAAGGAGG - Intergenic
1104091461 12:125521248-125521270 GGAGAATGAGAAAGAGAAGGAGG - Intronic
1104951834 12:132444581-132444603 TGAGAAAGACACAGACAAGGCGG - Intergenic
1105460655 13:20582565-20582587 GGAGAAAGACAGGGGGATGGTGG + Intronic
1105591007 13:21792767-21792789 GGAGAGAGACGGAGGGAAGGAGG - Intergenic
1105623815 13:22093958-22093980 GGAGGGTGACTAAGGGAAGGAGG + Intergenic
1106853286 13:33818383-33818405 GAAAAATAACACAGGGAAGGGGG + Intronic
1107122423 13:36810072-36810094 GGAGAAGGTCACAGGGAAAGTGG - Intergenic
1107577355 13:41741037-41741059 GGAAAATAAAGCAGGGAAGGGGG - Intronic
1107925559 13:45258389-45258411 GGAGAATGAAAGTGGGAGGGAGG - Intronic
1108147479 13:47494762-47494784 GGAGAATGAAACAGGGGGGAGGG + Intergenic
1108185042 13:47880373-47880395 GGAGAAAGAGAGAGGGAAGGAGG + Intergenic
1108591882 13:51919799-51919821 AGAAAATGTCACAGGGACGGTGG - Intergenic
1108675556 13:52735015-52735037 TCAGAAAGAGACAGGGAAGGAGG - Intronic
1110100449 13:71594980-71595002 GAAAAATAAAACAGGGAAGGAGG + Intronic
1111175904 13:84596077-84596099 GGAGGAAGAGAGAGGGAAGGGGG - Intergenic
1111217716 13:85165562-85165584 GGAGAAAAACAGAGAGAAGGGGG - Intergenic
1112634961 13:101206206-101206228 AGAGAAAGATACAGGGAGGGAGG - Intronic
1112929432 13:104715561-104715583 GGAGAAAGACAGAGAGAAGGGGG + Intergenic
1112990463 13:105507038-105507060 GAAAAATAACACAGGGCAGGAGG + Intergenic
1113397394 13:109961326-109961348 GGACAGAGGCACAGGGAAGGAGG - Intergenic
1113612867 13:111660082-111660104 GGAGATCAACACAGGGAAGTTGG + Intronic
1113892425 13:113743435-113743457 GGAGAAAGAAGCAGGGAAAGAGG + Intergenic
1113909761 13:113836430-113836452 GGAGAATGGGGAAGGGAAGGAGG + Intronic
1114330209 14:21629154-21629176 GGAGAGAGAGACAGTGAAGGGGG + Intergenic
1114412929 14:22517637-22517659 GGGCAATGACAGAGGGAAGATGG + Intergenic
1114439645 14:22735941-22735963 GGAAAATGGCACAGTGAAGAGGG - Intergenic
1114530049 14:23389796-23389818 GGGGAATGCCAGAGGGCAGGAGG + Intronic
1114537316 14:23431315-23431337 GGAGAAAAACAGAGGGAGGGAGG + Intronic
1115945436 14:38654494-38654516 GGAAAATGAAGCAGGGAAGGAGG - Intergenic
1116359442 14:43974837-43974859 AAAGAATGAAACAGGGAAGGAGG - Intergenic
1116857548 14:49966397-49966419 GGAGCATGACAGAGGAGAGGTGG + Intergenic
1116863834 14:50015590-50015612 GGCCAATGACACCTGGAAGGAGG - Intergenic
1116894478 14:50302637-50302659 GGAAAGTAAGACAGGGAAGGAGG - Intronic
1116975349 14:51109792-51109814 GGAGCAAGAGACAGGGGAGGAGG + Intergenic
1118319862 14:64746735-64746757 GGGGAAGGAGAGAGGGAAGGAGG + Exonic
1118824312 14:69366664-69366686 GGAGTATGAGGCAGGGAGGGAGG - Intergenic
1119555346 14:75548351-75548373 GGGCACTGACACAGGGAAGCAGG - Intergenic
1119556165 14:75554569-75554591 GGAGGATGACACACCCAAGGAGG - Intergenic
1119804347 14:77473064-77473086 GGAGAAAGACACTGCGCAGGTGG - Intergenic
1119823056 14:77635231-77635253 GGAGAGTCACTCAGAGAAGGAGG + Intergenic
1120572822 14:86143074-86143096 AGAGAATGACAGAGGAGAGGTGG + Intergenic
1120873734 14:89360339-89360361 GGAGAAAGAGAAAGGGAGGGAGG + Intronic
1121092374 14:91191556-91191578 GGAGAATGAGGCTGGGAAGGAGG - Intronic
1121544606 14:94754260-94754282 AGAGAGAGACACAGGGAAGAAGG + Intergenic
1121697889 14:95928084-95928106 GGAGAAGGAGAGAGGGATGGAGG - Intergenic
1121697910 14:95928164-95928186 GGAGAAGGAGAGAGGGATGGAGG - Intergenic
1121697972 14:95928383-95928405 GGAGAAGGAGATAGGGAGGGAGG - Intergenic
1121698024 14:95928620-95928642 GAACAGTGAGACAGGGAAGGGGG - Intergenic
1121943052 14:98091745-98091767 GGAAAATGAGACACGGAAGGAGG + Intergenic
1121993330 14:98582466-98582488 GGAGACCGGCACCGGGAAGGGGG - Intergenic
1122142089 14:99668596-99668618 GGAGGAAGACGCAGGGAGGGCGG - Intronic
1122323991 14:100871832-100871854 TGAGGATGACACATGGCAGGAGG - Intergenic
1122357154 14:101130123-101130145 GGAGAAAGAGACAAGGGAGGAGG + Intergenic
1123177169 14:106430960-106430982 GCAGAATGCAACAGTGAAGGAGG - Intergenic
1123403592 15:20008032-20008054 TGGGAAGGGCACAGGGAAGGAGG - Intergenic
1123512928 15:21014677-21014699 TGGGAAGGGCACAGGGAAGGAGG - Intergenic
1124908884 15:33898563-33898585 GGACAGAGACACAGGGAAGAAGG - Intronic
1125466451 15:39957752-39957774 GGAAGATGACACAGGGAAAGTGG + Intronic
1125679075 15:41519627-41519649 GGAGCATGACAAAGGGCAGAAGG - Intronic
1125854921 15:42939487-42939509 GGAGAATTACAGACAGAAGGAGG - Intergenic
1125870920 15:43101148-43101170 GGAGAATGTAACAGGAAATGAGG + Intronic
1126467501 15:48974144-48974166 GTAGAATCACACTGGCAAGGTGG + Intergenic
1126811826 15:52414206-52414228 AGAGAATGTCACAGGGCAAGTGG - Intronic
1126814904 15:52445260-52445282 GGAGCAAGAGACAGAGAAGGTGG - Intronic
1126947877 15:53844464-53844486 GGACACTGAGGCAGGGAAGGTGG + Intergenic
1127309929 15:57743588-57743610 GGAGTGTGTGACAGGGAAGGAGG + Intronic
1127647309 15:60971595-60971617 CGAGAATGATACAGGGGAAGAGG - Intronic
1128234265 15:66056834-66056856 AGAGAATGACAGGGTGAAGGGGG - Intronic
1128290552 15:66475419-66475441 GCAGAGTGACACAGGGAAGCTGG - Intronic
1128474954 15:67989346-67989368 GGAGAGTGAGGCAGGGAAGGAGG - Intergenic
1128480642 15:68034938-68034960 GGAGAAAGAGAGAGGGAGGGAGG - Intergenic
1128886080 15:71289437-71289459 GGAGAGTGCGGCAGGGAAGGAGG - Intronic
1129169984 15:73801717-73801739 GGGTAGTGAGACAGGGAAGGAGG + Intergenic
1129376824 15:75138740-75138762 GAAGGGGGACACAGGGAAGGAGG + Intergenic
1129887046 15:79045786-79045808 AGAGAAGGACACAGGGAAGGTGG + Intronic
1131003438 15:88956466-88956488 GGAGAGAGACAGAGTGAAGGGGG - Intergenic
1131017011 15:89066365-89066387 GGAGAGATACACAGGGAAGAGGG - Intergenic
1131018502 15:89077771-89077793 GGAGAATGAAACTTGGCAGGAGG - Intergenic
1131034368 15:89211498-89211520 GAAAAATGAAGCAGGGAAGGAGG + Intronic
1131107187 15:89743304-89743326 GGAGAAGAACCCAGAGAAGGAGG + Exonic
1131342690 15:91617396-91617418 GGAGAGAGAGAGAGGGAAGGGGG + Intergenic
1131366492 15:91846276-91846298 GGAGAGAGAGACAGGGAGGGAGG - Intergenic
1131526168 15:93154454-93154476 AGCGAATGACAGAGGGAAAGGGG - Intergenic
1131690402 15:94820945-94820967 GGAGAAGGAGAAAGAGAAGGAGG + Intergenic
1131907444 15:97158586-97158608 GGAGAAAGACACAGGAGAGCAGG + Intergenic
1132117149 15:99145811-99145833 TGAGAGAAACACAGGGAAGGTGG + Intronic
1132798676 16:1740873-1740895 CGAGACTGACACTGAGAAGGTGG + Intronic
1133316188 16:4885486-4885508 GGAGAAGGTCACAGAGAAAGAGG - Exonic
1133485365 16:6214535-6214557 GGAGAAGGAGACAGGGAGAGGGG + Intronic
1133501965 16:6375315-6375337 GAGAAATGACACAGGGAAGGTGG - Intronic
1133566873 16:7004060-7004082 CTAGAATGATACAGAGAAGGTGG - Intronic
1133819166 16:9221447-9221469 GGAAAATGAGACAGGGAAGGTGG - Intergenic
1134398661 16:13889076-13889098 GGAGAAGGAGAAAGGGGAGGGGG - Intergenic
1134691142 16:16191722-16191744 GAGGAAGGACAGAGGGAAGGAGG - Intronic
1134880789 16:17743806-17743828 GGAGAAGCAGACAGGGAGGGAGG + Intergenic
1135175719 16:20226956-20226978 AGAGAATGAAGCAGGGAAGGCGG + Intergenic
1136026535 16:27472406-27472428 GGAAAGTGACATGGGGAAGGAGG - Intronic
1137223513 16:46480081-46480103 GGGGAATGACAAAGGGTATGAGG - Intergenic
1137268437 16:46886667-46886689 GGTGAATGAGACAGAAAAGGTGG + Intronic
1137399886 16:48144661-48144683 GGAGAGTGATGTAGGGAAGGAGG - Intronic
1137902681 16:52286078-52286100 GGAAAATGACCCTTGGAAGGGGG + Intergenic
1137938245 16:52656182-52656204 CGAAAAAGACACAGGGAAGGAGG - Intergenic
1138082361 16:54102742-54102764 GGAGAAGGAGACAGTGCAGGCGG - Intronic
1138195905 16:55051933-55051955 GGGGAGTGAGACAGGGAAGGTGG - Intergenic
1138218539 16:55227357-55227379 AGAGAAAGAGAGAGGGAAGGAGG - Intergenic
1138240686 16:55424844-55424866 GGAGAAGGAGAAAGAGAAGGAGG - Intronic
1138381543 16:56606347-56606369 GGATAATGACTCAGGGAAGGTGG - Intergenic
1138458810 16:57135969-57135991 GGAGAAGGAGGGAGGGAAGGAGG + Intronic
1138998984 16:62485764-62485786 GAAGAAGGAGACAGGGAAGAGGG + Intergenic
1139220056 16:65172273-65172295 GGAGAAGTACAGAGTGAAGGTGG - Intergenic
1140257483 16:73349669-73349691 GGAGAGGGAGAGAGGGAAGGAGG - Intergenic
1140257499 16:73349712-73349734 GGAGAGGGAGAGAGGGAAGGAGG - Intergenic
1140487869 16:75308317-75308339 AAAGAATGAGACAAGGAAGGAGG - Intronic
1141204080 16:81919908-81919930 GGAGAAAAACACTGGGCAGGTGG + Intronic
1142009005 16:87704344-87704366 CTTGAATGTCACAGGGAAGGAGG + Intronic
1142142155 16:88477266-88477288 GGAGAAGGGCACGGGGAAGGTGG + Intronic
1143225439 17:5298589-5298611 GAATCATGACACATGGAAGGTGG - Intronic
1143580211 17:7821217-7821239 GGAGAAAGGGACAGGGAAGAGGG - Intronic
1143711287 17:8736934-8736956 GAAGAAAGAAAGAGGGAAGGAGG + Intronic
1143875767 17:9989643-9989665 GGAGAATAAAGCAAGGAAGGGGG + Intronic
1144004153 17:11085124-11085146 TGAGAATGAGACAGGGAAGGAGG + Intergenic
1144197123 17:12905223-12905245 AGAGAATGAGATAGGGCAGGAGG + Intronic
1144313038 17:14031118-14031140 GGAGAAGGAGGCAGAGAAGGAGG + Intergenic
1144556618 17:16288051-16288073 GGAGAAAGACACAGAGAAAGGGG - Intronic
1144699194 17:17325737-17325759 GGAGAAGCACACAGAGAGGGGGG - Intronic
1144843039 17:18200265-18200287 GAGGAATGAAAGAGGGAAGGAGG + Intronic
1145777670 17:27540665-27540687 GGAGAGGCACACAGGGAAAGTGG - Intronic
1145846395 17:28042210-28042232 GCAGAATAAGCCAGGGAAGGAGG - Exonic
1146700360 17:34953418-34953440 GGAGAATCACTCTGGGAGGGAGG - Intronic
1147421112 17:40322607-40322629 GGCGAGGGACAGAGGGAAGGAGG - Intronic
1147521403 17:41177013-41177035 GAAGAATGACCCTGGGAAGGAGG + Intergenic
1147550236 17:41436642-41436664 GGAGAATTAGACAGGGACAGGGG + Exonic
1147649492 17:42053907-42053929 CCAGAGTGACAGAGGGAAGGGGG + Intronic
1147701912 17:42401588-42401610 GGAGAGAGACAGAGGGAGGGAGG + Intergenic
1148686527 17:49504029-49504051 GGAGGGGGAGACAGGGAAGGAGG - Intronic
1148695413 17:49555564-49555586 GGGGCATGAAACAGGAAAGGAGG + Intergenic
1149283718 17:55137288-55137310 GCAGAAGGACAGAGGGAGGGAGG - Intronic
1149635772 17:58168128-58168150 AGAGATTGAGACAGGGCAGGGGG + Intergenic
1151399096 17:73843911-73843933 GGAGACTGCGGCAGGGAAGGTGG - Intergenic
1151659149 17:75509450-75509472 GGAACATGGCACAGGGAGGGAGG + Intronic
1151978130 17:77493728-77493750 GGACAGAGACACAGGGAAGAAGG - Intronic
1152110558 17:78355462-78355484 GGAGAATACCTCAGAGAAGGTGG + Intergenic
1152118301 17:78402263-78402285 GGGAAGTGAAACAGGGAAGGAGG - Intronic
1152136105 17:78504653-78504675 GGGTAATGAGACAGGGGAGGGGG + Intronic
1152256873 17:79245012-79245034 GGAGAAAGAAAGAAGGAAGGAGG - Intronic
1152328737 17:79658264-79658286 GGAGGAGGAGACAGGGAGGGAGG - Intergenic
1152993000 18:379516-379538 GGAGAATGACAAAGGGAAAAAGG + Intronic
1153588788 18:6651409-6651431 GGAGAGTGAGGAAGGGAAGGAGG - Intergenic
1153687177 18:7557980-7558002 GGAGAATGGGACTGGGAATGGGG - Intergenic
1154239397 18:12638804-12638826 GGAGGAAGAAAGAGGGAAGGAGG - Intronic
1155115975 18:22767483-22767505 GATGAAGGACACAGGGAAGTGGG - Intergenic
1155543171 18:26887504-26887526 GAACAATATCACAGGGAAGGTGG + Intergenic
1155660058 18:28238746-28238768 GGAGAAGGTCAAAGGGAAAGTGG + Intergenic
1155870148 18:31016887-31016909 GGAAAATAAGATAGGGAAGGAGG - Intronic
1156408519 18:36805964-36805986 GGAAAATGATAAAGAGAAGGGGG - Intronic
1156457904 18:37304968-37304990 GGAGCATGGCTCAGGGATGGTGG + Intronic
1156789313 18:40952617-40952639 GGAGCAAGACAGAGGGAATGGGG - Intergenic
1157134350 18:45039342-45039364 TGAGACTGACACAGTGGAGGTGG - Intronic
1157258251 18:46157259-46157281 AGAGAGTGACCCAAGGAAGGAGG + Intergenic
1157696186 18:49725808-49725830 GGAGACTGAGCCAGGAAAGGTGG - Intergenic
1157888235 18:51389422-51389444 GGAGAGAGACAGAGTGAAGGGGG + Intergenic
1159034954 18:63267829-63267851 AGAGAAAGACAGAGGGAAGGAGG - Intronic
1159042555 18:63338432-63338454 GGAAAATGATACTGGGAAGCAGG + Intronic
1159042949 18:63342663-63342685 GGAGGAGTACACAGGGAATGGGG + Intronic
1159422150 18:68235062-68235084 GGCAAGTGAAACAGGGAAGGAGG + Intergenic
1159513135 18:69422168-69422190 GGAGGAGAAGACAGGGAAGGCGG - Intronic
1160068898 18:75607218-75607240 GGAGAAGGACACAGGGGGGCCGG - Intergenic
1160133464 18:76250656-76250678 GGAGAATGAGACTGAGAAGAAGG + Intergenic
1160498311 18:79388077-79388099 GGAGAGTGACTCTGGGAGGGCGG + Intergenic
1160705051 19:525775-525797 AGAGAAGGAGAGAGGGAAGGAGG + Intergenic
1160940510 19:1618511-1618533 GGAGAGGGAGAGAGGGAAGGGGG - Intronic
1161045200 19:2130812-2130834 GGAAAGTCACACAGGGAACGAGG + Intronic
1161056423 19:2192924-2192946 AGAGAAGCACACAGGGACGGGGG - Intronic
1161629087 19:5342628-5342650 GGATATTGACAAAGGTAAGGGGG + Intergenic
1161750064 19:6089378-6089400 GAGCAATGTCACAGGGAAGGGGG + Intronic
1161905431 19:7152930-7152952 GGAGAAAGAAACAGAAAAGGGGG + Intronic
1162535499 19:11261355-11261377 GGACAAGAAGACAGGGAAGGGGG - Intronic
1162947063 19:14050530-14050552 AGAGAATCAAACAAGGAAGGTGG + Intronic
1162966456 19:14158475-14158497 GGAGAATGCCACAGTGAAGCTGG - Exonic
1162983815 19:14256481-14256503 GGAGAAAGAGAGAGGGAGGGAGG - Intergenic
1163164894 19:15489116-15489138 AGAGAATGACACAGGGCAAAGGG + Intronic
1164504709 19:28850252-28850274 GGAGAATGAGACAGTGAGGCTGG - Intergenic
1164919249 19:32076617-32076639 GGTGCAGGACACAGGGAATGTGG - Intergenic
1165067872 19:33239526-33239548 GGAGCAGGAGGCAGGGAAGGAGG - Intergenic
1165197747 19:34118162-34118184 GGAGAAGGACAAGGGGGAGGAGG + Intergenic
1165346209 19:35250010-35250032 GGTGAATGGCAAAGGGAAGAGGG + Intronic
1165361295 19:35338466-35338488 GAAGATGGACACAGGGAACGGGG + Intronic
1166212505 19:41316133-41316155 GGAAAAATAAACAGGGAAGGAGG - Intronic
1166933923 19:46319816-46319838 GGAGGAAGACTGAGGGAAGGGGG - Intronic
1166976732 19:46609326-46609348 GGAGAGAGACTCAGGGAAGAAGG - Exonic
1167100902 19:47403673-47403695 GGGGAATGGCACAGGGATGTGGG + Intronic
1167168741 19:47817184-47817206 GGAGACTGAGCCTGGGAAGGAGG + Intronic
1167252452 19:48407303-48407325 GGAGATGGACAGAGGGAGGGAGG - Intronic
1167463377 19:49638095-49638117 GGAGAAGGAGACGGGGGAGGAGG - Intronic
1167698869 19:51030686-51030708 GGAGGATGAATCAGGGAAAGGGG - Intronic
1168099684 19:54134324-54134346 GGAGAGAGAGAGAGGGAAGGTGG - Intergenic
1202709700 1_KI270714v1_random:11167-11189 GGAGAATGAACTAGGGAAGCAGG - Intergenic
925006864 2:450119-450141 GGAGGATGACACAGAGCAGGTGG + Intergenic
925914489 2:8595252-8595274 GGAAAATGTCCCAGGGACGGAGG + Intergenic
926055598 2:9772181-9772203 GCAGAAGCACAAAGGGAAGGTGG + Intergenic
926125560 2:10269844-10269866 GGAGAATGAAGCAGCGGAGGTGG - Intergenic
926933286 2:18062066-18062088 GTATAAGGACACAGGGAAAGAGG + Intronic
927050760 2:19326010-19326032 GGAGAAGGAGACAAGGAAGAGGG + Intergenic
927558280 2:24050620-24050642 GGAAAGTGAGACACGGAAGGGGG - Intronic
927650461 2:24910085-24910107 GGTGAATGAAACAGCGCAGGTGG + Intronic
927766096 2:25809787-25809809 CGAAAAAGACACAGGGGAGGTGG + Intronic
927884926 2:26712573-26712595 GTGGACAGACACAGGGAAGGGGG - Intronic
928233228 2:29518032-29518054 GGAGAATAAAACAGGGTTGGTGG + Intronic
929058749 2:37901962-37901984 GGAGAATGAAAGAGAGAAGGAGG - Intergenic
929324013 2:40583854-40583876 TGAGAAAGACAAAGGAAAGGTGG - Intronic
931304592 2:61016606-61016628 GGAGCCTGACACATGAAAGGCGG - Intronic
931528014 2:63179480-63179502 GGAGAAGGAGAAAGAGAAGGGGG - Intronic
931713906 2:65013111-65013133 GAAGAAAGACAGGGGGAAGGTGG + Intronic
931903272 2:66815079-66815101 GGAGAAAGAGAGAGAGAAGGGGG - Intergenic
933595044 2:84274873-84274895 AGAGAAAGAGAAAGGGAAGGAGG + Intergenic
934464231 2:94244697-94244719 AGAGAAGGACAGAGGGAAAGGGG - Intergenic
935265630 2:101391518-101391540 GGAGAATGAATCAGAGAAGTAGG - Intergenic
935265753 2:101392449-101392471 AGGGAATGACACACAGAAGGAGG + Intergenic
935329959 2:101969639-101969661 GCAGAATGTAACAGTGAAGGAGG - Intergenic
935363570 2:102267683-102267705 TGAGAATGAGGGAGGGAAGGAGG - Intergenic
935422265 2:102881454-102881476 AGAAAATGAAACAGGGAAGTAGG + Intergenic
935438990 2:103069382-103069404 GGAAGATGAGAGAGGGAAGGAGG - Intergenic
935578787 2:104737449-104737471 GGAGAGAGAGACAGGGGAGGTGG - Intergenic
935584146 2:104785467-104785489 CGAGAATGAACCAGGGAAGATGG + Intergenic
936121207 2:109746899-109746921 GGAGAAAGACAAAGGGGAGTTGG - Intergenic
936223489 2:110624572-110624594 GGAGAAAGACAAAGGGGAGTTGG + Intergenic
936474404 2:112827139-112827161 GGAGAGTGAGAGAGTGAAGGGGG - Intergenic
937088857 2:119191587-119191609 GAAGAATGAAACAAGGAAGTAGG - Intergenic
937451860 2:122008767-122008789 GCAAAAGGACACAGGGCAGGCGG - Intergenic
937462923 2:122104787-122104809 GGAGCAAGAGACAGGGGAGGAGG + Intergenic
937629049 2:124078804-124078826 GGAGAGGGATGCAGGGAAGGAGG + Intronic
937995587 2:127691803-127691825 GGAGGAAGAAACAGGGAGGGGGG + Intergenic
938099713 2:128490447-128490469 GGAGAAGGAGGAAGGGAAGGGGG + Intergenic
938198532 2:129354094-129354116 TGGGGATGACACAGGGAGGGAGG + Intergenic
938341442 2:130539182-130539204 GGAGCAAGCCACAGGGATGGGGG + Exonic
938348387 2:130581527-130581549 GGAGCAAGCCACAGGGATGGGGG - Intronic
938547287 2:132346325-132346347 GGAGGATGACTCAGGGAGGACGG - Intergenic
938774067 2:134525712-134525734 GGAGTGTTAGACAGGGAAGGAGG - Intronic
939223848 2:139339822-139339844 GGAGAGAGAGAGAGGGAAGGGGG + Intergenic
939571785 2:143848467-143848489 AGAGAATGACAGAGGGAAACAGG - Intergenic
939997323 2:148932059-148932081 AGAGGAAGACAGAGGGAAGGAGG + Intronic
940196015 2:151094847-151094869 GGAGAAAGAGAGAGAGAAGGGGG + Intergenic
941468568 2:165858135-165858157 GATGAAGGAAACAGGGAAGGGGG + Intronic
941631030 2:167884375-167884397 GGAGAATGGAAGAGGGAAGAAGG - Intergenic
942211273 2:173673430-173673452 GGAGAGCGAAACAGGGAAGGAGG - Intergenic
942595407 2:177587446-177587468 GAAGAATAGCACAGGGAATGTGG - Intergenic
943055723 2:182976039-182976061 GGAGAATGAAACTGGGAAAGGGG + Intronic
943338402 2:186646636-186646658 GGAGAATGACAGAAGTAAGGAGG - Intronic
943513195 2:188851973-188851995 GGAGAATGAGAGCGGGAAGCTGG - Intergenic
946133204 2:217623473-217623495 GGAGCATGAAACAAGGAAGTGGG - Intronic
946309968 2:218877984-218878006 GGAGAAGGTCACAGGGAGGAAGG - Intergenic
946495845 2:220194527-220194549 GGAGAAAGACAGAGTGAAGAGGG - Intergenic
946758080 2:222966252-222966274 AGAAAATGACACAGTGAAGGTGG - Intergenic
946915056 2:224510451-224510473 GGAGAATTATAAAGAGAAGGAGG - Intronic
947253349 2:228134175-228134197 GGAGGAAGACAGAAGGAAGGAGG + Intronic
947421368 2:229943994-229944016 GGAGGAAGACAGAGAGAAGGGGG - Intronic
947488374 2:230573011-230573033 TGAAAAAGACACAGGGAAGGAGG + Intergenic
947944894 2:234092930-234092952 GGTAAGAGACACAGGGAAGGAGG - Intergenic
948077362 2:235175173-235175195 GGAGAAAGACGCAGGGGATGTGG + Intergenic
948477005 2:238226809-238226831 GGAGGATGAGACAGAGGAGGGGG - Intronic
948569165 2:238906744-238906766 GGATTCTGCCACAGGGAAGGAGG - Intronic
948844896 2:240678394-240678416 AGACAATGACACAGAGGAGGCGG + Intronic
948848964 2:240696485-240696507 AGACAATGACACAGAGGAGGCGG - Intronic
1168848750 20:962246-962268 GGAAAATGACTCCGGGGAGGGGG + Intronic
1168989133 20:2079360-2079382 GGAGAATGACAGCGGGAAGGAGG - Intergenic
1169082125 20:2804019-2804041 GGAAAATGGCACAGTGAAGAGGG - Intergenic
1169282509 20:4279628-4279650 GGAGAAGGAAACCAGGAAGGTGG - Intergenic
1169681289 20:8216948-8216970 GGAGAATGTCCCTGGTAAGGGGG - Intronic
1169779510 20:9293974-9293996 GGAGAATGTAAAAGGAAAGGTGG + Intronic
1169870094 20:10240572-10240594 GGAGAATGGCAGAAGGAAGCAGG - Intronic
1169940103 20:10927683-10927705 AGAGAATGAGATAGGGAGGGAGG - Intergenic
1170318501 20:15068589-15068611 GGAGCAAGAGAGAGGGAAGGAGG - Intronic
1170421568 20:16198604-16198626 GAAGAATGACACCGGGAGGAGGG - Intergenic
1170485088 20:16807622-16807644 AGAGAATGAGGCAGGGAGGGTGG - Intergenic
1171876157 20:30579078-30579100 GGAGGATGACTCAGGGAAGACGG - Intergenic
1172122738 20:32608280-32608302 GGAGGAAGAGACAGGGGAGGGGG - Intronic
1172234322 20:33359769-33359791 TGAGAACAAGACAGGGAAGGTGG + Intronic
1172360526 20:34309843-34309865 GGAGCAGGACAGAAGGAAGGAGG + Intronic
1172653441 20:36522085-36522107 GGAGAATGACAGAGGTGGGGAGG - Intronic
1172694971 20:36816199-36816221 GGAGAATGACAGCATGAAGGAGG - Exonic
1172840372 20:37899398-37899420 GCACAATTACACAGGGGAGGAGG + Intergenic
1172846644 20:37933553-37933575 GCAGGAAGACGCAGGGAAGGAGG + Exonic
1172860514 20:38046599-38046621 AGGGAATGACACACTGAAGGTGG + Intronic
1173107385 20:40150826-40150848 GGGGAATGAGCCAGGGAAGGAGG - Intergenic
1173158914 20:40638147-40638169 AGAAAATGACAGAGGAAAGGGGG + Intergenic
1173690973 20:44960579-44960601 CGTGGATGACGCAGGGAAGGAGG + Intergenic
1173734812 20:45352414-45352436 GGACCAAGAGACAGGGAAGGTGG - Intergenic
1173953486 20:47011786-47011808 GAAGAATGAAGCAGGGAAGGAGG - Intronic
1174087043 20:48016712-48016734 GGAGAAGGACCCATGGAAGGGGG + Intergenic
1174357655 20:50009439-50009461 GGGGAATAATGCAGGGAAGGGGG - Intergenic
1174481401 20:50833827-50833849 GGAGCATTAGACAGGGAAGCAGG + Intronic
1174850154 20:53986212-53986234 AGAAAAAGACAGAGGGAAGGAGG - Intronic
1175099877 20:56571265-56571287 GGAGAAAGATATAGTGAAGGGGG + Intergenic
1175239783 20:57538567-57538589 GGGAAATGACACGGGGAAGAAGG + Intergenic
1175349026 20:58305210-58305232 GTTGAATTACACATGGAAGGTGG - Intergenic
1175452088 20:59077912-59077934 GGAGAAAGAGAAAGGGAAGAAGG + Intergenic
1175520263 20:59598254-59598276 GGAGAATATCAAAGGGCAGGTGG + Intronic
1175543196 20:59761221-59761243 GGAGCAGGGCACAGGGAGGGAGG - Intronic
1175879551 20:62249242-62249264 GGAGAAGGACAAAGGGCAAGAGG + Intronic
1175921428 20:62452131-62452153 GGAGAAGGAGAGAGAGAAGGAGG + Intergenic
1176309142 21:5140581-5140603 GGAGAAGGACACAGGGACCATGG - Intronic
1176342689 21:5713397-5713419 GGAGTAATACACAGAGAAGGAGG - Intergenic
1176474943 21:7145548-7145570 GGAGTAATACACAGAGAAGGAGG - Intergenic
1176502138 21:7611059-7611081 GGAGTAATACACAGAGAAGGAGG + Intergenic
1176537010 21:8111466-8111488 GGAGTAATACACAGAGAAGGAGG - Intergenic
1176801075 21:13431584-13431606 GGTTAAAGACACAGGGAAGTTGG - Intergenic
1176974703 21:15307201-15307223 AAAGAATTACAAAGGGAAGGGGG - Intergenic
1177249372 21:18572261-18572283 GGAGAAGGAGAAAGGGGAGGAGG + Intergenic
1177283753 21:19021098-19021120 GGAGAAGGTCAAAGGGAAGCAGG - Intergenic
1177858879 21:26429223-26429245 GGAGGATGACCCAGGGACTGGGG + Intergenic
1177913502 21:27058792-27058814 GGAGAAAGACATAGGCTAGGAGG - Intergenic
1178391854 21:32205391-32205413 GGAGAATGAGACAGATAAGAAGG - Intergenic
1178505031 21:33155160-33155182 GGAGAGAGATAGAGGGAAGGAGG + Intergenic
1178507835 21:33177213-33177235 GGAGGAAGAGAGAGGGAAGGAGG - Intergenic
1178769633 21:35491005-35491027 GGAGAATGAAACAGGGAAGGAGG + Intronic
1178877160 21:36422293-36422315 GCAGAATGACACCGGCATGGGGG - Intergenic
1179130188 21:38629200-38629222 GGAGAAAGAACCAGGGATGGAGG - Intronic
1179196241 21:39165208-39165230 GAAGAATGGCACATGGAAGAGGG + Intergenic
1179393768 21:41018449-41018471 GCAGAATACCAGAGGGAAGGAGG + Intergenic
1179399400 21:41070083-41070105 GGAGAATAACATGGGGAGGGAGG - Intergenic
1179659495 21:42865393-42865415 AGAGGATGCCACAGGGAGGGGGG + Intronic
1179847919 21:44121452-44121474 GGAGAAGGACACAGGGACCATGG + Intronic
1180121358 21:45750560-45750582 GGGGAACGAAAGAGGGAAGGAGG - Intronic
1180613028 22:17109670-17109692 GGAGCAGGACCCAGGGAAGCCGG + Exonic
1182007049 22:26969739-26969761 GAAGAGAGACAAAGGGAAGGAGG - Intergenic
1182084272 22:27550808-27550830 AGAGAGTGAGACAGGGAAGGAGG + Intergenic
1182122096 22:27794886-27794908 GGAGGATGAGAAGGGGAAGGGGG + Intronic
1182287545 22:29257215-29257237 GGGAAATGGGACAGGGAAGGAGG + Intronic
1182522158 22:30890846-30890868 GTAGGAGGACACAGAGAAGGCGG - Exonic
1182675623 22:32036814-32036836 GGAGACAGACACAGAGAAGATGG + Intergenic
1182779986 22:32859768-32859790 GGAGAAGGGCAAAGGGAAGAGGG - Exonic
1183260442 22:36791560-36791582 TAAGAACGAAACAGGGAAGGTGG + Intergenic
1184345433 22:43909976-43909998 GGAGAAAGAGAGAGGGAGGGAGG + Intergenic
1184449685 22:44575630-44575652 GGAGGATGACAAGGAGAAGGGGG + Intergenic
1184613851 22:45624580-45624602 TTGGAATGACACATGGAAGGCGG - Intergenic
1185120221 22:48961836-48961858 GGAGAGAGAGAGAGGGAAGGGGG + Intergenic
1185288594 22:50013244-50013266 GGAGGACCACACAGGGGAGGTGG - Intergenic
1185372526 22:50467654-50467676 GGAGGATGCCACAGAGAGGGAGG - Exonic
1203241961 22_KI270733v1_random:27870-27892 GGAGTAATACACAGAGAAGGAGG - Intergenic
949385470 3:3497264-3497286 GGAGAAGAACACAGGGAGGCAGG + Intergenic
949432422 3:3991864-3991886 AGAGAAGGACGGAGGGAAGGAGG + Intronic
949547791 3:5087155-5087177 GGGGAGTGAAACAGGGAAGGAGG + Intergenic
949551525 3:5116060-5116082 AGAGAAAGAGAGAGGGAAGGAGG - Intergenic
949553794 3:5134838-5134860 AAAGAATGACATAGTGAAGGTGG - Intronic
950488820 3:13289853-13289875 AGGGAAGGACTCAGGGAAGGTGG - Intergenic
950552678 3:13676218-13676240 GGAAGATGTCACAGGGGAGGGGG - Intergenic
950582149 3:13869648-13869670 GTAGAAAGAAAGAGGGAAGGAGG + Intronic
951566193 3:24014691-24014713 GAAGAATGAGACTGGGAAGTAGG - Intergenic
951732311 3:25823824-25823846 GAGGAATGCAACAGGGAAGGAGG + Intergenic
951844029 3:27066173-27066195 GGAGAGAGACAGAGAGAAGGGGG + Intergenic
952114661 3:30164219-30164241 GGGGAATGGCACAGGGAACTGGG - Intergenic
952255452 3:31691324-31691346 GGCGAAGGACACTTGGAAGGAGG + Intronic
952512551 3:34071781-34071803 GGACAAGGAAACAGGAAAGGGGG + Intergenic
952656184 3:35788548-35788570 GGAGGTTGAAACAGGGAAGGCGG - Intronic
952870459 3:37895596-37895618 GGAGAATGACACTTGGAAAATGG - Intronic
953046472 3:39297708-39297730 GGGAAATGAGACAAGGAAGGTGG + Intergenic
953394553 3:42557152-42557174 CGACAAAGACACAAGGAAGGTGG + Intronic
953751034 3:45608550-45608572 GGAGAATGACGCTGGGCACGTGG + Intronic
954573845 3:51663840-51663862 GGAGAATGAGTGAGAGAAGGAGG + Exonic
954830362 3:53416321-53416343 GGAGAAACCCACAGGGAAGCTGG + Intergenic
955049484 3:55395680-55395702 GGAGAAGGACACAGGGAACTGGG + Intergenic
955349474 3:58183245-58183267 GCAAAAAGACACAGGGAAGAGGG + Intergenic
955492615 3:59498429-59498451 GGGTCATGAGACAGGGAAGGGGG - Intergenic
955887767 3:63618921-63618943 GGAGAATGAGACAGGAAAGGAGG + Intergenic
956294376 3:67695954-67695976 GAAGACTGAAACAGGGAAGGAGG - Intergenic
957809955 3:85208631-85208653 GCAGAATGACAGAGGTAAAGAGG + Intronic
958816477 3:98921883-98921905 AGAAAATGACAGTGGGAAGGGGG + Intergenic
958894432 3:99814241-99814263 AGAGAATGAGACAAAGAAGGAGG - Intergenic
958936373 3:100260580-100260602 GGGAATTGACATAGGGAAGGCGG - Intergenic
959661650 3:108875192-108875214 GGAGAAAGAGAAAGGGAAAGAGG + Intergenic
959889029 3:111533636-111533658 AAAGAGTGAAACAGGGAAGGAGG + Intronic
959904356 3:111694095-111694117 GAAGAAAGACTCAGGAAAGGAGG - Intronic
959963827 3:112332275-112332297 GGAGAAGGAGACGGAGAAGGAGG + Intergenic
960718619 3:120603385-120603407 GAAGAGTGAAACATGGAAGGAGG + Intergenic
961774190 3:129272279-129272301 GGAGAATGTCACAGTGCAGATGG + Exonic
961813896 3:129537971-129537993 GGAGATTAACACAGAGAGGGGGG + Intergenic
961825563 3:129597410-129597432 GGAGAAGGGCACAGGCAAGGGGG + Intronic
962017266 3:131454444-131454466 TGGGTATGACACAGGGGAGGGGG + Intergenic
962979528 3:140475004-140475026 GGAGAATGAGTTAAGGAAGGAGG - Intronic
963474184 3:145782276-145782298 GGAGGATGAGACAGAGAAAGAGG + Intergenic
963627821 3:147695227-147695249 GGAGACAGACAATGGGAAGGAGG + Intergenic
964202081 3:154128858-154128880 GAAACATGAAACAGGGAAGGGGG - Intronic
964562121 3:158009607-158009629 GGAGAAGTACTCAGCGAAGGGGG + Intergenic
964645943 3:158958724-158958746 GGAGGAAGAAACAGTGAAGGGGG + Intergenic
965862879 3:173168539-173168561 GGAGAATTACACAGAGGAAGAGG + Intergenic
966034643 3:175396806-175396828 GGAGAAGCACAGAGTGAAGGTGG - Intronic
966734892 3:183180475-183180497 TGAGAAAGAGACAGGGGAGGAGG - Intronic
967653064 3:192010093-192010115 GGAGGATGACACAGAGGATGAGG + Intergenic
967957599 3:194889186-194889208 GGAGAGCCACACAGGGAAGCTGG - Intergenic
967993899 3:195152490-195152512 GGAAAGTGACACAGGGATCGTGG - Intronic
968341843 3:197962117-197962139 GGAGACTGGCACAGGACAGGAGG - Intronic
968645474 4:1738409-1738431 GGGCTCTGACACAGGGAAGGAGG - Intronic
968885107 4:3324729-3324751 GAAGAAGGCCAAAGGGAAGGAGG - Intronic
968942065 4:3644044-3644066 GGAGACGCACACAGGGACGGAGG + Intergenic
968942946 4:3648549-3648571 GGAGAATGAAGCGGGGAAGGAGG - Intergenic
969057376 4:4410169-4410191 GGAGAGGGACACAGGTCAGGAGG - Intronic
969103762 4:4789622-4789644 GGAGAGAGAGACAGTGAAGGAGG - Intergenic
969492538 4:7508202-7508224 GGAGAAGGAGGGAGGGAAGGGGG + Intronic
969504274 4:7574545-7574567 GGAGAGAGACAGGGGGAAGGAGG + Intronic
969534343 4:7746807-7746829 GGACTATGAGACAGGGATGGAGG - Intergenic
969709020 4:8832051-8832073 GGAGGCTGTCACAGAGAAGGAGG + Intergenic
970499829 4:16665872-16665894 AGATAAAGACACAGGGAAGGAGG + Intronic
970567094 4:17342072-17342094 GGAGAAAGAGAGAGAGAAGGGGG - Intergenic
970580480 4:17470313-17470335 GAAGAGTGAAACAGGGCAGGAGG + Intronic
971028721 4:22613620-22613642 AGAGAAACACACATGGAAGGAGG - Intergenic
971213712 4:24644329-24644351 GGAGAGAGAGAGAGGGAAGGGGG - Intergenic
971597782 4:28553974-28553996 GGAGAAGTGCCCAGGGAAGGGGG + Intergenic
971982952 4:33778373-33778395 GGAGAAAGACAGAGGGCAAGAGG + Intergenic
973790454 4:54373556-54373578 TGAGAAGGACACAGGAAGGGGGG + Intergenic
973835623 4:54806443-54806465 GGAGAAGGAGAGAGGGAGGGAGG + Intergenic
974743177 4:66034474-66034496 GGAGAAAGAGAGAGAGAAGGGGG + Intergenic
974855142 4:67452424-67452446 GGAGAAAGAGAAAGTGAAGGGGG - Intergenic
975151689 4:71029673-71029695 GGGGAATGACAGAAGGAAGCTGG - Exonic
975411377 4:74054970-74054992 GGAGAAAGAGGTAGGGAAGGGGG + Intergenic
975593426 4:76023156-76023178 AGAGAAGGAAAAAGGGAAGGAGG - Intronic
975770195 4:77712025-77712047 GAAGAATGAAATAGGGAAGGAGG - Intergenic
975866657 4:78730749-78730771 AGGGAATTAGACAGGGAAGGAGG - Intergenic
976033815 4:80791921-80791943 GGAGAATGACACTGAGGAGCAGG + Intronic
976042851 4:80907614-80907636 GGAGAATTGCAGAGTGAAGGAGG + Intronic
977580369 4:98718240-98718262 GAAGAGTGAGAAAGGGAAGGAGG - Intergenic
978326120 4:107558634-107558656 GGGGAATGAGAAAGGGAAAGTGG - Intergenic
978733807 4:112062518-112062540 AGAGAAAGACAGAGGGAGGGAGG + Intergenic
978739234 4:112119001-112119023 GGAGAAGGAAACAGGAGAGGAGG + Intergenic
979558889 4:122080009-122080031 GGAGAAAGAGAGAGTGAAGGAGG - Intergenic
980113638 4:128658696-128658718 GGAGAAGGAAAAGGGGAAGGGGG + Intergenic
980888894 4:138793216-138793238 GGAGGAAGAGAGAGGGAAGGGGG - Intergenic
981081038 4:140639797-140639819 GGAGACTCACACAGGGTTGGAGG - Intronic
981584791 4:146289251-146289273 GGAGAATGGGAAAGGGAAGCAGG - Intronic
981817092 4:148843089-148843111 GGAGAAGGAAGCAGGGGAGGGGG - Intergenic
981960389 4:150530642-150530664 GGAAAATGGAACAGGGAAAGGGG - Intronic
982402341 4:154982403-154982425 AGAGAATGAGACAGGGAAGGAGG - Intergenic
982617070 4:157652267-157652289 GGAGCAAGAGAGAGGGAAGGAGG + Intergenic
982855567 4:160378160-160378182 AGAGAAAGACAAAGGGATGGAGG - Intergenic
983283501 4:165710429-165710451 GGAGAATGATAGAGGGAAGAAGG - Intergenic
983736769 4:171071436-171071458 GGAGAGAGAGACAGTGAAGGTGG + Intergenic
984067694 4:175069644-175069666 GAAGAAGGTCAAAGGGAAGGTGG - Intergenic
984085126 4:175300930-175300952 GGAGGAAGACAGAGTGAAGGGGG - Intergenic
984181168 4:176484261-176484283 GGGGAATGAGGCAGGAAAGGAGG + Intergenic
984396118 4:179201850-179201872 GGAAAATGAAACTGGGATGGGGG + Intergenic
984818197 4:183857687-183857709 GGAGAAAGAGACAGGGCTGGGGG - Intronic
984917569 4:184737728-184737750 GGAGATTAACACTGAGAAGGCGG - Intergenic
984939681 4:184920115-184920137 GGAGATTAACACTGAGAAGGCGG + Intergenic
985273403 4:188216166-188216188 AGGGAAGGAGACAGGGAAGGAGG - Intergenic
985273414 4:188216202-188216224 AGGGAAGGAGACAGGGAAGGAGG - Intergenic
985273446 4:188216297-188216319 AGGGAAGGAGACAGGGAAGGAGG - Intergenic
985273483 4:188216404-188216426 AGGGAAGGAGACAGGGAAGGAGG - Intergenic
985348300 4:189030996-189031018 GCATAATGACACAGTGAAAGAGG + Intergenic
985398433 4:189569357-189569379 GTAGAATGATACAGGGCAGAAGG - Intergenic
985677734 5:1240934-1240956 GGAGACAGACACAGAGGAGGAGG + Intronic
986522963 5:8641559-8641581 CCAGAATGGCACAGGGAAGTAGG - Intergenic
986981005 5:13448022-13448044 GCAGAAAGACAGAGGGATGGGGG - Intergenic
987037015 5:14029348-14029370 CGATAATGACACAGAGGAGGAGG + Intergenic
987188468 5:15449475-15449497 GGAGAATGAAATAGGGAAAGAGG - Intergenic
987278361 5:16386603-16386625 GGACAAAGACACAGGGACAGGGG - Intergenic
988399016 5:30736873-30736895 GGAGTATGAGTCAGAGAAGGAGG - Intergenic
988686535 5:33530602-33530624 GGAGAAAGACAGAGGAAGGGTGG + Intronic
989157157 5:38355115-38355137 GGAGAATGAGACAGGAAAGGAGG + Intronic
989425901 5:41295246-41295268 GAAGAGTGATGCAGGGAAGGAGG + Intergenic
989524975 5:42442878-42442900 GGAGAATGAGTCAGGGAAGAAGG - Intronic
990370737 5:55115587-55115609 GGAGAATGAGGGAGGAAAGGAGG + Intronic
990933708 5:61123137-61123159 AGAATATGAAACAGGGAAGGAGG - Intronic
991172584 5:63646026-63646048 GGAGGAAGACAGAGGAAAGGAGG + Intergenic
991507335 5:67339130-67339152 GGAGGAAGAGAAAGGGAAGGAGG - Intergenic
991507339 5:67339148-67339170 GGAGGAAGACAGAGGGAGGGAGG - Intergenic
991612849 5:68466635-68466657 AAAGAATGAAACAGGGAAAGAGG - Intergenic
991918652 5:71631494-71631516 GCAGCATGACATAGGGAAAGAGG + Intronic
992595914 5:78347288-78347310 GGAGAATGAGACAGGTAACAGGG - Intergenic
992946754 5:81818846-81818868 GGAAAATGAAGCAAGGAAGGGGG + Intergenic
993026173 5:82649477-82649499 GTAGACTGAGACATGGAAGGGGG + Intergenic
994475419 5:100262160-100262182 GGAGAAAGTCAAAGGGAAGTGGG - Intergenic
995235982 5:109831000-109831022 GGTGAAGGGCACAGGGATGGGGG + Intronic
995322603 5:110853755-110853777 GAAGAAGGAGACAGGGAAGAAGG + Intergenic
995433346 5:112107097-112107119 GAAGAGTGAGACTGGGAAGGAGG - Intergenic
996027136 5:118658667-118658689 GGAGAAAGAGAGAGTGAAGGGGG + Intergenic
996999655 5:129744353-129744375 CTAGAATCACACAGGGAAGGGGG + Intergenic
997398076 5:133580555-133580577 GCAAAATGAAACAAGGAAGGGGG + Intronic
997649385 5:135504380-135504402 GGTTAAGGCCACAGGGAAGGAGG + Intergenic
997977566 5:138449348-138449370 GGAGATTGTCCCAGGGAATGAGG - Intergenic
998446551 5:142203288-142203310 GAAGGAGGACACAGGGCAGGTGG + Intergenic
998935591 5:147229131-147229153 GGACAATGTCACCGGGAGGGGGG + Intergenic
999448517 5:151660640-151660662 GGAGAAGGACAGATAGAAGGAGG + Intergenic
999672406 5:153969213-153969235 AGATGAAGACACAGGGAAGGGGG - Intergenic
999839781 5:155412818-155412840 TGAGAATGATAAAGGGAAGCTGG + Intergenic
1000203955 5:159039167-159039189 GCAGAATGACTCAGGGAAGAGGG - Intronic
1000309049 5:160023796-160023818 TGAGAATGATACAGGCAAGAGGG - Intronic
1000537396 5:162495702-162495724 GGAGAGTGGTACAGGTAAGGAGG - Intergenic
1000997609 5:167974375-167974397 GGAGAAGGAAAGAAGGAAGGAGG + Intronic
1001340405 5:170838210-170838232 GAAGAAAGAGAGAGGGAAGGAGG + Intergenic
1001371759 5:171211237-171211259 GGAAAATAAGGCAGGGAAGGGGG - Intronic
1002401305 5:178992864-178992886 AGAGAAAGAAAGAGGGAAGGTGG + Intronic
1003708233 6:8559481-8559503 GCAGAATATCAGAGGGAAGGAGG - Intergenic
1003779298 6:9405132-9405154 GGAGAATAAGAGAGGGGAGGAGG + Intergenic
1004413250 6:15400894-15400916 GAAGAAGGACAGAGGGAGGGAGG - Intronic
1004478065 6:15992772-15992794 GGAGCAAGAGACAGGGGAGGAGG - Intergenic
1004800255 6:19138718-19138740 GGAGTAGGAAAGAGGGAAGGAGG + Intergenic
1005369921 6:25121787-25121809 GGAGAAAGAGAAAAGGAAGGAGG + Intergenic
1005814901 6:29542610-29542632 GGAGATTCACACAGGGAGGCAGG - Intergenic
1005928001 6:30460717-30460739 GGAGAATGAAGGAGGGAGGGAGG - Intergenic
1005988108 6:30886538-30886560 GGAGGAGGACAAAGGGATGGGGG + Intronic
1006339794 6:33440576-33440598 GGTGAGAGAGACAGGGAAGGAGG - Intronic
1006652439 6:35562816-35562838 GGAGAAGGAGAAAGGGAAGGGGG + Intergenic
1006932173 6:37695124-37695146 ACCCAATGACACAGGGAAGGAGG + Intronic
1007116921 6:39349413-39349435 GGAGTATGACAAAGGGAATGAGG + Intronic
1007225318 6:40309645-40309667 GGAGCAAGACAGAGGGGAGGAGG + Intergenic
1007251812 6:40500306-40500328 GGAGAAGGCCACAGGGGACGTGG + Intronic
1007364901 6:41384483-41384505 GGAGAGTGAGTGAGGGAAGGGGG - Intergenic
1007731995 6:43953031-43953053 GGAGAAAGATAAAGGGAAAGGGG - Intergenic
1007782704 6:44263559-44263581 GGAGAGTGACGGAGGGAGGGAGG + Intronic
1008408660 6:51147542-51147564 GGAAATTGACACAGGAAAGTGGG + Intergenic
1008834707 6:55811666-55811688 GGAGAAAGAGAGAGGGAAGGAGG - Intronic
1009228724 6:61039745-61039767 GGACAATATCACAGGGAGGGGGG + Intergenic
1009518860 6:64656739-64656761 GGAGGATGAGAAGGGGAAGGGGG + Intronic
1010272705 6:73932595-73932617 AGAGAGTGAGATAGGGAAGGAGG + Intergenic
1010495823 6:76532932-76532954 GGAGAGGCTCACAGGGAAGGGGG + Intergenic
1010704421 6:79090223-79090245 GGGGAATGAAGGAGGGAAGGAGG - Intergenic
1011303545 6:85901835-85901857 GCAGAGTGAGGCAGGGAAGGAGG + Intergenic
1011480025 6:87784574-87784596 GTAGAGTGAGGCAGGGAAGGAGG + Intergenic
1011719858 6:90144333-90144355 TGGGAAGGACAGAGGGAAGGAGG + Intronic
1012141699 6:95633375-95633397 GGAGAAAGAAAAAGGGAAGGAGG - Intergenic
1013139337 6:107315844-107315866 GGAGAAATACACTGGGAAGGTGG + Intronic
1013190675 6:107802471-107802493 GCAGAGTGACAGAGGGAAGGCGG + Intronic
1013225662 6:108118147-108118169 AGAGAATGAGACAGGGAGGGAGG + Intronic
1013627922 6:111955986-111956008 GGAGAAGGACATAGTAAAGGAGG + Intergenic
1014368537 6:120576123-120576145 GCAGAATAACACAGGCAAGTTGG + Intergenic
1014886972 6:126793626-126793648 GAAAAGTGAGACAGGGAAGGAGG + Intergenic
1015327239 6:131937117-131937139 GCAGAATCACACAGAGAAGCTGG + Intergenic
1016521063 6:144947418-144947440 AGAGAATAAAGCAGGGAAGGAGG - Intergenic
1016861322 6:148721478-148721500 GGAGAGTAACAGAGGGAAGCCGG - Intergenic
1017192608 6:151669883-151669905 GGAGAAGGACACATGGGAGAGGG + Intronic
1017595996 6:156029165-156029187 AGAAAATAGCACAGGGAAGGTGG - Intergenic
1018140542 6:160829677-160829699 GGAGAGGGAGAAAGGGAAGGAGG + Intergenic
1018520357 6:164642244-164642266 AGAGAAAGAGAAAGGGAAGGAGG - Intergenic
1018747433 6:166773230-166773252 GGAGAAGGAGGCAGGGAAGGGGG + Intronic
1018960958 6:168448317-168448339 GGAGGATGGCACTGGGGAGGAGG + Intronic
1019151736 6:170010968-170010990 GAATAAGGACAGAGGGAAGGAGG + Intergenic
1019290301 7:247005-247027 GGAAAAGGAAAGAGGGAAGGAGG + Intronic
1019772790 7:2894329-2894351 GGAGAAGGAGGCAGGGAAGGAGG - Intergenic
1019795121 7:3043444-3043466 GGAGAGTGAGAGAGAGAAGGGGG + Intronic
1019849727 7:3542463-3542485 AGAGAAGGACCCAGGGAAGAGGG + Intronic
1020011506 7:4808061-4808083 GGAGAGAGACAGAGGGAGGGAGG - Intronic
1020212164 7:6165433-6165455 GGAGAAAGAGAGAGGGGAGGCGG + Intronic
1020240403 7:6390034-6390056 GGAGAAGGAAGGAGGGAAGGAGG - Intronic
1021469208 7:20981914-20981936 GGAGAAGAAGACAAGGAAGGTGG + Intergenic
1021535814 7:21703206-21703228 GCAGAATGAAACAGGAAGGGTGG + Intronic
1022514722 7:30968314-30968336 GGAGAATGACACAGGGAAGGAGG + Intronic
1022807435 7:33836908-33836930 GGAGAGTGAGAAAGGGAAGAAGG + Intergenic
1022994988 7:35746278-35746300 GGAAAATAAAACAGGGAATGGGG + Intergenic
1024091498 7:45946089-45946111 GGAGAAGGCAACAGGCAAGGTGG - Intergenic
1024800108 7:53067267-53067289 GGAGAGAGAGAGAGGGAAGGTGG + Intergenic
1024919982 7:54545662-54545684 GGGGAAAGAGAGAGGGAAGGGGG + Intronic
1025611663 7:63080211-63080233 AGAAGTTGACACAGGGAAGGAGG + Intergenic
1026124828 7:67570373-67570395 GGGGATTGACAGTGGGAAGGGGG + Intergenic
1026191865 7:68136281-68136303 GGAGAAGGAGAAAGAGAAGGAGG + Intergenic
1026305290 7:69134986-69135008 GGAGAAGGAGAGAGGGAGGGAGG - Intergenic
1026494193 7:70888396-70888418 GGAGAAAGAAAGAGAGAAGGAGG + Intergenic
1026837611 7:73648849-73648871 GGAGAATGAGAGAGAGAGGGGGG - Intergenic
1027131121 7:75592154-75592176 AAAGAAAGACAAAGGGAAGGAGG + Intronic
1027160796 7:75800709-75800731 GAAAAATGACACGGGGGAGGCGG + Intergenic
1027301240 7:76838473-76838495 GGAGAATCTCACAGGCAAGGGGG + Intergenic
1027802154 7:82767999-82768021 GGAGAAAGAGACAGGGAGGGAGG + Intronic
1028491349 7:91415407-91415429 CCAGAATGAAGCAGGGAAGGAGG - Intergenic
1028516931 7:91688012-91688034 GGACAATAACAAAGGAAAGGTGG + Intergenic
1028865024 7:95699277-95699299 GGAGAAAGAGAGAGAGAAGGGGG + Intergenic
1029710077 7:102294701-102294723 GCTGCAAGACACAGGGAAGGGGG - Intronic
1029997739 7:105025062-105025084 GGAGAATGACATGTGGAACGTGG + Intronic
1030344523 7:108417389-108417411 CAAGAGAGACACAGGGAAGGGGG + Intronic
1030423257 7:109336809-109336831 GGAGACAGACACAGAGAAAGAGG + Intergenic
1030875533 7:114809021-114809043 GAAGAATGACTCTGGGAAGTTGG + Intergenic
1030930901 7:115522174-115522196 GCAGAATGCCAGAGAGAAGGAGG - Intergenic
1031462436 7:122068127-122068149 TGAGAATGAATCAGGGAAAGGGG - Intergenic
1032205603 7:129862480-129862502 GGAGAAAAACACAGCAAAGGAGG + Intronic
1032985243 7:137330304-137330326 GGAGAAGGAGAAAGAGAAGGAGG + Intronic
1033473492 7:141669068-141669090 GGAGAGGGATACAGGGGAGGGGG - Intronic
1033656980 7:143381292-143381314 GGGGAGGGACACACGGAAGGAGG - Exonic
1033730024 7:144169279-144169301 GCAGAATTACACAGGGAAATTGG - Intergenic
1033889598 7:145994988-145995010 GGAGAAGGAGAAAGAGAAGGAGG - Intergenic
1034721097 7:153293618-153293640 GGAGAAAGCCACAGGGAAGGAGG + Intergenic
1035116554 7:156529448-156529470 GGAGAAGTACAGAGCGAAGGGGG + Intergenic
1035225971 7:157432390-157432412 GGAGAATGAGACAGGCAGGCCGG - Intergenic
1035389748 7:158496747-158496769 GGAGGGGGGCACAGGGAAGGTGG - Intronic
1035847584 8:2882115-2882137 AGAGAAAGAAACAGGGAGGGAGG + Intergenic
1036120016 8:6006173-6006195 GGTGAAGGCCACGGGGAAGGAGG + Intergenic
1036648222 8:10625402-10625424 GAGGAAAGACACAGGGAAGAGGG + Intronic
1037663935 8:20951558-20951580 GGAAAAAGAGACAGAGAAGGAGG - Intergenic
1037680285 8:21091737-21091759 GAAGAGTAACCCAGGGAAGGAGG + Intergenic
1037844164 8:22268007-22268029 GGGGAATGACGCAGGGAGGGAGG - Intergenic
1038575248 8:28699403-28699425 GGAGACTGAGACAGGGGAGCAGG + Intronic
1038761931 8:30392416-30392438 GAAGAATGAAACTGGGGAGGGGG + Intronic
1039538933 8:38345359-38345381 GGAGAAGGAGACAGGGAGAGAGG + Intronic
1041370489 8:57154633-57154655 GCAGAATGAGAGAGGGAATGGGG - Intergenic
1042397697 8:68311084-68311106 AGGGAAGGAGACAGGGAAGGAGG - Intronic
1042431002 8:68706394-68706416 GGAGAGTGACACTGTGAAAGAGG + Intronic
1043083600 8:75798428-75798450 GAAGAATCACACAAGGAAGTAGG + Intergenic
1043417243 8:80063904-80063926 GGGGAATGGCAGAGGGAGGGAGG + Intronic
1043782701 8:84356040-84356062 GGAGAGAGACAGAGTGAAGGGGG - Intronic
1043998398 8:86847576-86847598 GGAGAGAGAGAGAGGGAAGGAGG + Intergenic
1044814158 8:96093514-96093536 AGAGAAAGACACAGAGCAGGAGG - Intergenic
1045545844 8:103127299-103127321 GGAGAGTGAAAAAGGGAAAGTGG - Intergenic
1045600423 8:103708594-103708616 AGAGAATGATTTAGGGAAGGTGG - Intronic
1046391395 8:113577344-113577366 GGAGAAAGAGAGAGTGAAGGGGG - Intergenic
1046419157 8:113957094-113957116 GGCGAGTGAGACAGAGAAGGAGG + Intergenic
1048195205 8:132326936-132326958 GGAAAATGAAACAGGGAAAGAGG - Intronic
1048510174 8:135054962-135054984 GGTGAATGCCAGAGTGAAGGTGG + Intergenic
1048560840 8:135535906-135535928 GGAGAAGGACATAGGATAGGTGG + Intronic
1048574449 8:135679892-135679914 GGAGAAGGATCCAGGGTAGGAGG - Intergenic
1048651601 8:136484496-136484518 GCAGAATGACTGAGGGAATGGGG - Intergenic
1049444844 8:142625133-142625155 AGAGACTGACAGAGAGAAGGAGG + Intergenic
1049472576 8:142782978-142783000 GGAGCATGACGCAGGGAATATGG + Intergenic
1049472937 8:142784328-142784350 GGAGTATGACGCAGGGAATATGG - Intergenic
1049579034 8:143402603-143402625 GGAGAAGCACAGAGAGAAGGCGG - Intergenic
1049760234 8:144328919-144328941 GGAGAAAGACAATGGGAGGGTGG + Intergenic
1049788188 8:144461349-144461371 AGGGAAAGACACAGGGAAGGTGG + Intronic
1049913474 9:293448-293470 GGAGAAGGACAAGGAGAAGGTGG + Intronic
1050182490 9:2935370-2935392 GAAGAATGAGGCAGGGAATGAGG - Intergenic
1050188769 9:3002938-3002960 GGAGAGTGAGGCAGAGAAGGAGG - Intergenic
1050476965 9:6050212-6050234 GGAGTCTGATACAGGGAAAGGGG + Intergenic
1051044149 9:12853514-12853536 GGTGAATGAAACAGCGAAGGAGG - Intergenic
1051187905 9:14479982-14480004 GGAGAAGGAGGCAGGGAGGGAGG + Intergenic
1051569539 9:18540394-18540416 GGAGAGTGACACAGGGATGGAGG + Intronic
1052355690 9:27502818-27502840 AGAGAATGTCACAGGAAAGTAGG + Intronic
1053825895 9:42024102-42024124 GGAAAATATGACAGGGAAGGTGG - Intronic
1054604668 9:67163291-67163313 GGAAAATATGACAGGGAAGGTGG + Intergenic
1054776572 9:69128870-69128892 GGAAAAGGACATAGGGAAAGAGG + Intronic
1055042428 9:71889526-71889548 GGCAAATTACACAGGGAAGTTGG + Intronic
1055411698 9:76037281-76037303 GGAGAATGTCTCAGAGAAGCTGG + Intronic
1055601732 9:77926198-77926220 GGAGAATGACACATGAAATTTGG - Intronic
1055661784 9:78511203-78511225 GGGGATTGATACTGGGAAGGAGG + Intergenic
1055677791 9:78682854-78682876 GGAGAAGGAGAGAGGGAAGGGGG - Intergenic
1055773780 9:79745913-79745935 TGAGAATGAAAGAGGGAAAGAGG - Intergenic
1056697692 9:88873913-88873935 GGAGAATGAAGCAGGGCCGGTGG - Intergenic
1057415022 9:94854081-94854103 GGAGAATGAAAAAGGTAAGTTGG + Intronic
1058388828 9:104471005-104471027 GAAGAAAGACACAGTGAGGGGGG + Intergenic
1059453105 9:114383168-114383190 GGAGAATGAACCAGGGAGGCTGG + Intronic
1059760242 9:117330611-117330633 GTAGAATGACACAGAGGAAGGGG - Intronic
1059877796 9:118655395-118655417 GGAGAATGAGTCAGAGAAAGAGG + Intergenic
1060426651 9:123511992-123512014 GGAAAATGACAAAGGGAGAGAGG + Intronic
1060496963 9:124126069-124126091 GGAGGATTACACAAGGTAGGGGG - Intergenic
1060908603 9:127330670-127330692 GGAGAATAACAGCAGGAAGGAGG + Intronic
1061235669 9:129341414-129341436 GGGGAATGCTGCAGGGAAGGAGG - Intergenic
1061315969 9:129795978-129796000 GGAGAATGACTCAGAGAGGATGG + Intergenic
1061715141 9:132514218-132514240 GGTCAATAACACAGGGAAGGGGG - Intronic
1061862804 9:133476568-133476590 GCAGCATGACGCTGGGAAGGAGG + Intronic
1062128890 9:134882053-134882075 TGAGAAGGACACAGGGAGAGAGG - Intronic
1062172332 9:135141963-135141985 GAAGAATGCCACAGGGGATGGGG - Intergenic
1062269037 9:135700356-135700378 GGGGGATGACGGAGGGAAGGGGG + Intergenic
1062543602 9:137052258-137052280 GGAGAACGACACAGGCATTGTGG - Exonic
1062621416 9:137423922-137423944 GGTGACTCACACCGGGAAGGGGG + Intronic
1203458278 Un_GL000220v1:10947-10969 GGAGTAATACACAGAGAAGGAGG - Intergenic
1185452158 X:288418-288440 GGAGACAGACACAGAGGAGGAGG - Intronic
1185888188 X:3801759-3801781 GGAGACAGGCACAGAGAAGGAGG + Intergenic
1186319661 X:8410633-8410655 GGAGAAATACCCAGGGAAGGGGG + Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1186659059 X:11649534-11649556 GGATAATGAAATGGGGAAGGAGG - Intronic
1187164029 X:16787670-16787692 GGGGACTGAGACTGGGAAGGTGG + Intronic
1187195484 X:17079459-17079481 GGAAAGTGAGACAGGGCAGGAGG - Intronic
1187236966 X:17476626-17476648 AGAATATGATACAGGGAAGGAGG + Intronic
1188419324 X:29976473-29976495 GGATAGAGACACAGAGAAGGTGG - Intergenic
1188430866 X:30104543-30104565 GGATAGAGACACAGAGAAGGTGG - Intergenic
1188643357 X:32534423-32534445 GGAGAGTGAGACAGTGCAGGGGG - Intronic
1188894024 X:35644087-35644109 GGAGAAGGAGACAGGGGAGCAGG + Intergenic
1189200315 X:39189737-39189759 GGAGAGTGACACAATGAAGTAGG + Intergenic
1189524508 X:41805638-41805660 GGGGAAAGAGAAAGGGAAGGGGG + Intronic
1189623122 X:42865376-42865398 TGATAAGGACACAGGGAAGTAGG - Intergenic
1189742511 X:44134483-44134505 GCAGAGTGGAACAGGGAAGGAGG - Intergenic
1189988862 X:46576143-46576165 GGGAAATGAGAGAGGGAAGGAGG - Intronic
1190368342 X:49718545-49718567 GGAGGACGAGACAGAGAAGGGGG + Intergenic
1190739667 X:53280722-53280744 GGAGAATGGCCAAGGGGAGGAGG + Intronic
1190931388 X:54951793-54951815 GTGGAATGACCCAGGGATGGGGG - Intronic
1191105276 X:56768544-56768566 GGAGAAAGATAAAGGCAAGGTGG - Intergenic
1191106269 X:56773946-56773968 GGAGAAAGATAAAGGCAAGGTGG - Intergenic
1191107262 X:56779348-56779370 GGAGAAAGATAAAGGCAAGGTGG - Intergenic
1192313344 X:70034055-70034077 GGAGAATGACAGCAGGAAGGAGG - Intronic
1192428816 X:71099142-71099164 GGGGAAAGGCACTGGGAAGGAGG + Intronic
1193606986 X:83581106-83581128 GGACAATGAAACTGGGAGGGTGG + Intergenic
1194023736 X:88725779-88725801 GGAGCAAGAGAGAGGGAAGGGGG + Intergenic
1194416620 X:93620115-93620137 GGAGAATGGCAAAGAGAAGAGGG + Intergenic
1194825408 X:98556426-98556448 GGAGAAGTACAGAGTGAAGGTGG + Intergenic
1194988113 X:100513235-100513257 GGAGAATGAAAGAAGGATGGAGG - Intergenic
1195237647 X:102917557-102917579 AGGGAATGACAGAGAGAAGGTGG + Intergenic
1195728147 X:107938121-107938143 GGAGAACGAAAGAGGGAAGCAGG - Intergenic
1195923268 X:110002916-110002938 GGAGGAAGCCAGAGGGAAGGCGG - Intronic
1196058817 X:111385746-111385768 GGAGAAAGAGAGAGGGAGGGAGG + Intronic
1196172250 X:112602399-112602421 GGGAAGTGAAACAGGGAAGGAGG + Intergenic
1196185208 X:112738147-112738169 GGAGAAGGACACATTTAAGGTGG - Intergenic
1196764618 X:119231694-119231716 GGAAAATGAAGCAGGGAAGGAGG + Intergenic
1197381613 X:125749418-125749440 AGAGAAGGAGAAAGGGAAGGAGG - Intergenic
1197507490 X:127324911-127324933 GGAGAATAATACAGAGAAGGTGG + Intergenic
1197865094 X:131009145-131009167 GGAGAGAGAGAGAGGGAAGGCGG - Intergenic
1198139929 X:133792394-133792416 ATAGAATGAGACAAGGAAGGTGG + Intronic
1198254865 X:134915553-134915575 GGAGAGTGAGACAGGACAGGAGG - Intergenic
1198320471 X:135514594-135514616 GAGGAATAACACAGGGAAGGAGG - Intergenic
1198383452 X:136105428-136105450 GTAGGAACACACAGGGAAGGGGG + Intergenic
1198931574 X:141867225-141867247 GAAGAAAGAAACAGGAAAGGTGG + Intronic
1199544978 X:148998888-148998910 GGTGATGGACAGAGGGAAGGAGG - Exonic
1199693206 X:150324829-150324851 GGAGCATGACACAGGGAAAAAGG - Intergenic
1199814629 X:151386770-151386792 GGAGAAAGAGAGAGGGAGGGAGG - Intergenic
1199855533 X:151756155-151756177 GGAGAAAGAAGCAAGGAAGGAGG - Intergenic
1199989867 X:152980956-152980978 GGAGAATCAAGCAGAGAAGGAGG + Intergenic
1200122713 X:153798679-153798701 GGAGAGAGTCACTGGGAAGGTGG - Intergenic
1200140113 X:153896578-153896600 GGTGAATGAAGCAGGGCAGGAGG + Intronic
1200255874 X:154582588-154582610 GGAGAAAGAGAAAGTGAAGGGGG - Intergenic
1200257757 X:154593744-154593766 GCTGAAAGACACAGGGAGGGAGG + Intergenic
1200261895 X:154621815-154621837 GGAGAAAGAGAAAGTGAAGGGGG + Intergenic
1200836783 Y:7740112-7740134 GGAGAAAGACACAAGAAAGCTGG - Intergenic
1201701068 Y:16882745-16882767 AGAGAAGGACAGAGGGAGGGAGG + Intergenic
1201909728 Y:19121716-19121738 GGAGAAGGAAACAGAGAAGAAGG - Intergenic