ID: 1022514824

View in Genome Browser
Species Human (GRCh38)
Location 7:30968931-30968953
Sequence CCCTGGGTATGGGGCCTAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022514813_1022514824 13 Left 1022514813 7:30968895-30968917 CCTGTCTACAAGCAGCAGAGGAG 0: 1
1: 0
2: 0
3: 18
4: 168
Right 1022514824 7:30968931-30968953 CCCTGGGTATGGGGCCTAGGAGG 0: 1
1: 0
2: 2
3: 24
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022514824 Original CRISPR CCCTGGGTATGGGGCCTAGG AGG Exonic
900294546 1:1942464-1942486 CCCTGGGTGCGGGGCCCTGGAGG + Intronic
901011862 1:6206752-6206774 CCCGGGGGATGGGGTCTGGGGGG - Intronic
901261080 1:7871402-7871424 GCCTGGGCAGGGGGCCTGGGAGG - Intergenic
901518309 1:9764242-9764264 CCCTGGCTATGGGGGTGAGGTGG - Intronic
902216504 1:14937560-14937582 TCCTGAGTATGGGGCCTGGGTGG + Intronic
903925666 1:26828861-26828883 CCCTGGGTGTGGGGACTGAGAGG - Intronic
904424147 1:30412881-30412903 CCCTGGTGAAGGGGCCTAGGTGG + Intergenic
904435109 1:30489943-30489965 TCCTGGCTATGTGCCCTAGGAGG - Intergenic
904863607 1:33559360-33559382 CCCTGGGTATATGGCTGAGGGGG - Exonic
904884359 1:33725241-33725263 CCATGGGGATGGGGCCAAGCAGG + Intronic
905791386 1:40791529-40791551 CCCTGGGGATGAGGCACAGGAGG + Intronic
906138790 1:43520731-43520753 ACCAGGGTATGGGGCCTGGTGGG + Intergenic
909694828 1:78454956-78454978 CCCTGGGGGAGGGGCCTGGGTGG + Intronic
911044953 1:93620526-93620548 CTCTGCCTATGGGGCCTGGGTGG + Intronic
915575428 1:156773154-156773176 CCCGGGGTGTGGTGCTTAGGGGG + Intronic
918242213 1:182630516-182630538 CCATGGATATGGGGCTCAGGAGG + Intergenic
920076079 1:203337953-203337975 GCCTAGGCATGTGGCCTAGGCGG + Intergenic
920530158 1:206695938-206695960 CCCTGGACCTGGGGCCCAGGTGG - Intronic
1062977553 10:1696687-1696709 CCCAGGGTCTGGAGCCTGGGTGG + Intronic
1067930050 10:50551718-50551740 GCCTGGGTATGGGGTATGGGAGG - Intronic
1069619969 10:69831271-69831293 CCCTGGGTCTGGGTCCTGGCAGG - Intronic
1069819083 10:71216739-71216761 CTCAGGGAATGGGGCGTAGGAGG - Intronic
1069909505 10:71750849-71750871 CCCTGTGTCTGGTGCCTGGGAGG + Exonic
1070918385 10:80169155-80169177 CCCTGGGTATGGCGGATATGAGG + Exonic
1071339653 10:84632972-84632994 TCCTGGGAATGCGGCCCAGGAGG - Intergenic
1075106240 10:119542125-119542147 CCCTGGGCCTGGGGCGTCGGGGG - Intronic
1077247562 11:1546953-1546975 CTCCGGGTCCGGGGCCTAGGTGG - Intergenic
1077438321 11:2555594-2555616 CCCTGGGTATGATTCCTGGGAGG + Intronic
1079332642 11:19546390-19546412 CCCTGGGTGTGGGGCCCAGATGG + Intronic
1081870004 11:46379130-46379152 CCCAGGGCCTGGGGCCAAGGTGG + Intronic
1083328629 11:61886396-61886418 CTCTGGGGAAGGGGCCTGGGTGG + Intronic
1083448913 11:62729302-62729324 CTCTGGGGATGGGGCCGAGGAGG - Intronic
1083849236 11:65355450-65355472 GCCTGGGACTGGGGCCGAGGGGG - Intronic
1088039283 11:105357625-105357647 CCCTGGGTAGGGTGCCTTTGAGG + Intergenic
1088739984 11:112759384-112759406 CCCTGGAAATGGGTACTAGGAGG - Intergenic
1090627341 11:128618531-128618553 CACTGGGACGGGGGCCTAGGGGG - Intergenic
1090635745 11:128689674-128689696 CCGTTGGGATGGGGCCAAGGTGG - Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1091621644 12:2093605-2093627 CCCAGGGTAAGGGGCTCAGGAGG - Intronic
1092055957 12:5508125-5508147 TCATGGGTATGGGACCTGGGCGG - Intronic
1092194564 12:6541478-6541500 CCCTGGGCATGGGGCCTTCCAGG - Intronic
1096109982 12:49022861-49022883 TTCAGGGTATGGGGCCTGGGAGG + Exonic
1096976708 12:55703534-55703556 GCTTGGGGATGGGGCCAAGGAGG - Intronic
1104659643 12:130601307-130601329 CCCTGGGGATGGGGTCAAAGAGG + Intronic
1104692845 12:130839344-130839366 GCCTGGGGGCGGGGCCTAGGCGG + Intergenic
1104764087 12:131315310-131315332 CCCTGGGGATGGGGAGCAGGTGG + Intergenic
1105543764 13:21337296-21337318 CCCTGGGTGTGGGGCTGAGCAGG - Intergenic
1105623077 13:22087802-22087824 CACTAGGTATGGGCCCAAGGAGG - Intergenic
1106209446 13:27627960-27627982 ACCTGGATATGGGGCCTTTGGGG - Intronic
1112652869 13:101417182-101417204 CCCTGGGCATGGTGCTTAGGAGG - Intergenic
1113737623 13:112689865-112689887 CCCAGGGTCTGGGGCCCGGGCGG + Intergenic
1118819054 14:69333207-69333229 CCCTGGGTCAGGGGCCTGGGAGG + Intronic
1119203629 14:72777601-72777623 CTCTGGGGGTGGGGCCTAGTGGG + Intronic
1119481408 14:74960619-74960641 TCTTGAGTATGGGGTCTAGGAGG - Intergenic
1122773020 14:104105575-104105597 CCCGGGTTCTGGGGCCCAGGAGG + Intronic
1124177782 15:27442226-27442248 TCCTGGCTATGGGGCCTGGCTGG - Intronic
1125673252 15:41488336-41488358 CCCTGGGGATGGGGTAGAGGTGG + Intergenic
1128728497 15:70005169-70005191 CCCTGGGAATGGGGCTAAGAGGG + Intergenic
1129131985 15:73507517-73507539 CCCTAGGGAGGGGACCTAGGTGG + Intronic
1129360611 15:75021677-75021699 CCCAAGGCAGGGGGCCTAGGTGG - Intergenic
1130925624 15:88383616-88383638 CCCTGGGAATGGTGCCTAGGTGG - Intergenic
1132494465 16:254726-254748 CCCAGGGGATGGGGCGGAGGGGG + Intronic
1132499455 16:278905-278927 ACCTGGGTGTGGGGCATGGGAGG - Intronic
1134820665 16:17244253-17244275 CCCTGGGGGTGGGGCCTTGGGGG + Intronic
1137255232 16:46769562-46769584 CTCTGGGTATGGGGTCGAGGAGG - Intronic
1138422539 16:56908880-56908902 CCTTGGGTATGGTGCCTGGTGGG + Intronic
1141886055 16:86893068-86893090 CCCTGGGTCAGGGGGCTGGGAGG + Intergenic
1142367407 16:89657433-89657455 CCCTGGGGATGGGGTCCCGGGGG + Intronic
1144781306 17:17809868-17809890 GCCTGGGTCTGGGGCTTAGGCGG + Intronic
1144841933 17:18192093-18192115 CTCTGGAAATGGGGCCCAGGCGG + Intronic
1148020293 17:44548796-44548818 CCCTGGCTTTGGGGCAGAGGAGG - Intergenic
1148492551 17:48032645-48032667 CCAGGGGGATGGGGCCTCGGAGG + Intronic
1150652199 17:67017467-67017489 CACTGGGAATGGGGCACAGGGGG - Intronic
1151875757 17:76867503-76867525 GCCTGGGTATGGGGGATTGGAGG + Intergenic
1152309922 17:79543906-79543928 CCCTGGCTCTGGGGGGTAGGGGG - Intergenic
1152364013 17:79844833-79844855 CCCTGGGGTTGGGGGCTCGGGGG - Intergenic
1152639480 17:81443672-81443694 CCCTGGTCCTGGGGCCTCGGAGG - Intronic
1154100533 18:11468895-11468917 CACTTTGTGTGGGGCCTAGGAGG - Intergenic
1154416812 18:14179655-14179677 CCCTGGGACGGGGGCCTTGGAGG + Intergenic
1155028395 18:21962934-21962956 TCCTTGGTATGGGGCCTAGGAGG + Intergenic
1155281108 18:24240857-24240879 ACCTGGGTTTGGGCCCTAGAGGG - Intronic
1155647958 18:28103646-28103668 CTCAGGGGATGGGGGCTAGGGGG - Intronic
1156529970 18:37805890-37805912 CCCTGGGCCTGAGCCCTAGGGGG - Intergenic
1157547376 18:48555849-48555871 CACTGGGCATGGGGAATAGGGGG + Intronic
1158569624 18:58586611-58586633 CTCTGGGTATGGGGCTTTGAAGG - Intronic
1160770386 19:828395-828417 TCCTGGGGAGGGGGCCTAGGGGG + Intronic
1160783963 19:891288-891310 GCCTGGGGCTGGGGCCGAGGGGG + Intronic
1160946440 19:1646090-1646112 GCCTGGGTCTGGGGGCTGGGTGG - Intronic
1160972540 19:1775922-1775944 CCCTGGGGAGGGGGCCGGGGCGG - Exonic
1161961332 19:7524986-7525008 CCCCGGGTATGGGACCCAGGCGG + Exonic
1161993329 19:7697647-7697669 CCCTGAGCCTGGGGCATAGGCGG - Intronic
1162133989 19:8544178-8544200 CCCTGGATAAGGGTCCTAGCAGG + Intronic
1162572023 19:11479646-11479668 CCCTGGGGGCGGGGCCTAGATGG + Intronic
1162809266 19:13154415-13154437 GCGTGGGTGTGGGGCCTGGGAGG + Exonic
1162901468 19:13797342-13797364 CCCTGGGAAGGGGCCCCAGGAGG - Intronic
1162909547 19:13841859-13841881 CACTGGGTCTGGGGCCTGGCTGG + Intergenic
1162914828 19:13869099-13869121 CCCTGGGTTTGGGGTCAGGGTGG - Intronic
1163009945 19:14418901-14418923 GCCGGGGTCTGGGGCCTGGGTGG - Intronic
1163561815 19:18023689-18023711 CCCTGGCCATGGTGCTTAGGAGG + Intergenic
1163795677 19:19336606-19336628 CCCTGGGGCTGGGGCATAAGAGG - Intronic
1164609996 19:29625297-29625319 CCCCTGGAATGGGGCCCAGGCGG - Intergenic
1166147644 19:40848520-40848542 GCCTGGGGATGGGGACTAGGTGG - Intronic
1166151785 19:40880385-40880407 GCCTGCGGATGGGGACTAGGTGG - Intronic
1166178378 19:41090242-41090264 GCCTGGGGATGGGGACTAGGTGG + Intronic
1167722146 19:51186176-51186198 CCCTTGCTGTGGGGCCAAGGAGG - Intergenic
1167838634 19:52095800-52095822 GCCTGGGGGCGGGGCCTAGGCGG + Intergenic
928722879 2:34140900-34140922 CCCAGTGTATAGGGCCTAGTGGG - Intergenic
932594066 2:73083387-73083409 CCCTGGGTTTGGGACCTGTGAGG - Intronic
934059564 2:88281696-88281718 CCCTAGGAATGGGGCATAAGGGG - Intergenic
934573311 2:95385228-95385250 CCCTGGGGAAGAGGCCTTGGGGG + Exonic
934890442 2:98063676-98063698 CTCTGGGTATAGTGCCTATGGGG + Intergenic
935144931 2:100389124-100389146 CACTGGGTTGGGGGCCTTGGTGG + Intergenic
936820225 2:116510980-116511002 GCCTGGGTGTGGAGCATAGGAGG + Intergenic
938386780 2:130872446-130872468 GCCTGGGCAGGGGGCCTGGGGGG - Intronic
942574927 2:177353345-177353367 CCCTGGGGAAGGATCCTAGGCGG - Intronic
945034042 2:205688933-205688955 CCCTAGGCATGGGGCCGGGGAGG - Intronic
946130482 2:217602521-217602543 AACTGGCTGTGGGGCCTAGGGGG + Intronic
947733025 2:232441482-232441504 CCCTGGGGATGGTGCCTTGTTGG - Intergenic
948216130 2:236234239-236234261 CCCTGGCTATGTCCCCTAGGAGG + Intronic
948579491 2:238974724-238974746 CTCTGGGAATGGGGCTTTGGAGG - Intergenic
948615039 2:239193112-239193134 CCCTGTGTGGGGGGCCTGGGTGG + Intronic
1168774245 20:434893-434915 CCCTGGGGATGGGGCCATCGGGG - Intergenic
1171427202 20:25056837-25056859 GCCTGGGTGTGGGGCCTGCGGGG - Intronic
1172276833 20:33684739-33684761 CACTGGGCATGGGGCCAAGGGGG + Intronic
1172319634 20:33986263-33986285 CTCTGGGCATGCTGCCTAGGGGG + Intergenic
1173018559 20:39248269-39248291 CCCTGGGAGAGGGGCCTGGGGGG + Intergenic
1173448369 20:43140039-43140061 CGCTGGGGAAGGGGCCTGGGTGG - Intronic
1174134225 20:48367909-48367931 CTCTGGGTGTGGGGCCTGTGGGG - Intergenic
1175367998 20:58468427-58468449 ACCTGGGGATGGGGCAGAGGAGG + Intronic
1176197568 20:63844467-63844489 CCCTGGGTCTGGGGGCTATGAGG - Intergenic
1176856527 21:13979622-13979644 CCCTGGGACGGGGGCCTTGGAGG - Intergenic
1176868067 21:14064585-14064607 CCCTGGGACGGGGGCCTTGGAGG + Intergenic
1179598663 21:42461011-42461033 CCCTGGGCAGGTGCCCTAGGGGG - Intergenic
1179998474 21:44984709-44984731 CCCAGGGGAGGGGGCCGAGGTGG - Intergenic
1181466133 22:23111722-23111744 CCCTGAGGAAGGGGCCTGGGAGG - Intronic
1181469505 22:23129108-23129130 CTCTGGGTGGGGGGCCTGGGGGG - Intronic
1181540377 22:23569845-23569867 CCCTTGGTCTGGGGCCTGGGTGG - Intergenic
1182579015 22:31292649-31292671 CCCTGGGGATGCGGCCTCGCAGG - Intergenic
1182686930 22:32128289-32128311 CCCTGGGGGTGGGGCCCTGGAGG + Intergenic
1183492288 22:38123061-38123083 CCCTGGGGATGGGGCCAGGCGGG - Intronic
1184775785 22:46622016-46622038 CCCTGGGTTTGGGGCTGAGCCGG + Intronic
1184828755 22:46970828-46970850 CCCTGGGTGTATGGCCCAGGCGG - Intronic
1185275355 22:49948245-49948267 CCCTGGGTCTGGGACCTGGCTGG - Intergenic
950916081 3:16646629-16646651 CCGTGGGGATGGGGCCAAGAGGG + Intronic
952338726 3:32427448-32427470 CCCTCGGTATGGGGACCAGGAGG + Intronic
952796220 3:37241753-37241775 TCCTGGGGGTGGGGGCTAGGTGG + Intergenic
953743211 3:45554541-45554563 GCCTGGGCCTGGGGCCAAGGTGG + Intergenic
954698448 3:52439764-52439786 CCCTGAGTCTGGGGCCAGGGAGG + Exonic
955124252 3:56094495-56094517 ACCTGGGGATGGGACCTTGGGGG + Intronic
956703046 3:71975857-71975879 CCATGAGTATGGGTCCTAGAGGG - Intergenic
957584451 3:82115311-82115333 TCCTGGGGATGGGGCCAAGATGG - Intergenic
964452511 3:156825983-156826005 CCCTTGCTCTGGGGCCTATGTGG - Intronic
968080897 3:195846328-195846350 CCCAGGGTAGGGGACCCAGGAGG + Intergenic
968132301 3:196198733-196198755 CCCTGGGGGTGGGGCAGAGGTGG - Intronic
968353190 3:198080229-198080251 CCCTGGGACGGGGGCCTTGGAGG - Intergenic
968658721 4:1789906-1789928 CCCTGGGTATGGGCCTCAGGAGG + Intergenic
968708455 4:2095170-2095192 ACATGGGTATTGGGGCTAGGGGG + Intronic
968831512 4:2934724-2934746 CCCGGGGTGGGGGGCGTAGGGGG - Intronic
968855983 4:3122278-3122300 CACTGGGTCTGGTGCCTAGCAGG + Intronic
971237811 4:24858709-24858731 CCCTGGGTGTGGGAACTGGGAGG + Intronic
972254814 4:37342115-37342137 CACTGGGGATGGGGCCTGGTGGG + Intronic
972568194 4:40287480-40287502 CGTTGGATATGGGGCCTGGGGGG - Intergenic
976087342 4:81419834-81419856 TCCTGGGTCTGGGCCCCAGGAGG - Intergenic
976950811 4:90827904-90827926 CCCTGGTTATAGAGCCGAGGGGG + Intronic
978159231 4:105526611-105526633 CCTTGGGTATGAAGCCTCGGTGG + Intergenic
980888580 4:138789695-138789717 CTTTGGATATGTGGCCTAGGAGG - Intergenic
984725051 4:183012884-183012906 CTCTGGGTATGGGACCTGGGGGG - Intergenic
994197418 5:96935885-96935907 CGCTGGGGGCGGGGCCTAGGCGG - Exonic
997518340 5:134506369-134506391 GCCAGGGTGTGGGGCCCAGGAGG + Intergenic
998386198 5:141758431-141758453 CCCTGGGTCTGGGGCCTGGAAGG + Intergenic
998755886 5:145379192-145379214 CACTGGGGAAGGGGCCAAGGAGG + Intergenic
998983451 5:147729376-147729398 CCCTGGGTGTGGGGCAGGGGAGG + Intronic
999226847 5:150032771-150032793 CCCTGGCAATGGGGACAAGGAGG - Intronic
1001577520 5:172773831-172773853 GCCTGGATTGGGGGCCTAGGTGG - Intergenic
1001603849 5:172946311-172946333 CTGTGGGGATGGGGCCTGGGAGG - Intronic
1001984571 5:176061948-176061970 CCCCTGGGATGGGGCCTCGGAGG + Exonic
1002132469 5:177089988-177090010 CACTGGGTGTGTGACCTAGGAGG + Intronic
1002263048 5:178007570-178007592 CCCCTGGGATGGGGCCTCGGAGG + Intronic
1002660841 5:180790369-180790391 CCCAGGGGATGGGGGCCAGGTGG - Intergenic
1006091135 6:31629687-31629709 ACCTGGGTACAGGGCCTTGGGGG - Exonic
1006183281 6:32166653-32166675 CCCTGAGTACGGGTCCTAGTTGG - Intronic
1006639177 6:35480258-35480280 CCGTGGGTGAGGGGCCCAGGAGG + Intronic
1007543900 6:42676037-42676059 TCCTGTGTTTGGTGCCTAGGTGG + Exonic
1008468226 6:51854570-51854592 CCCTGGGTCTGAGCCCCAGGGGG - Intronic
1015018408 6:128442400-128442422 AGGTGGGTATGGGGTCTAGGAGG - Intronic
1019031733 6:169019139-169019161 GACTGGGGATGGGGCCCAGGTGG - Intergenic
1019506887 7:1395853-1395875 CCCTGGGTCTGGGTCCCAGACGG + Intergenic
1020256334 7:6504634-6504656 GGCTGGCTATGGGGCCTGGGAGG + Intronic
1022514824 7:30968931-30968953 CCCTGGGTATGGGGCCTAGGAGG + Exonic
1023874462 7:44279209-44279231 CCCAGGGTCTGGGGCCCAGATGG + Intronic
1025021904 7:55486887-55486909 CCCAGGGTGTGTGGCCTTGGGGG - Intronic
1026633386 7:72058664-72058686 CCCTGGGCAGAGGGCCAAGGGGG + Intronic
1026978371 7:74512544-74512566 CCCTGGGGCTGGGGCTAAGGGGG + Intronic
1029441511 7:100589578-100589600 CCATGGGGGAGGGGCCTAGGAGG + Intronic
1032145992 7:129381301-129381323 CCCTGCCTATGGGGACTGGGTGG - Intronic
1033684194 7:143623838-143623860 CACTGGGGATGGGGCCTCTGGGG - Intronic
1033687370 7:143703057-143703079 CACTGGGGATGGGGCCTCTGGGG - Exonic
1033700418 7:143833785-143833807 CACTGGGGATGGGGCCTCTGGGG + Intergenic
1035061684 7:156074200-156074222 TCCTGGGTGTGGGGCCTGAGGGG + Intergenic
1035280523 7:157775630-157775652 GCCTGGGTGTGGGGCTGAGGCGG + Intronic
1035655882 8:1304273-1304295 CCCTGGGTGTGGGGCCACGGTGG - Intergenic
1035750992 8:1996190-1996212 CCCTGGGAATAGCGCCTGGGTGG - Intronic
1037801405 8:22037760-22037782 CCCCAGGTATGGGGCCCAGGAGG + Intergenic
1043092096 8:75917758-75917780 TGCTGGATATGGGGCCTGGGGGG + Intergenic
1044518205 8:93165194-93165216 ACCTGTGTAATGGGCCTAGGAGG - Intronic
1045650092 8:104333614-104333636 TCCTGGGTCTGGGTTCTAGGTGG + Intronic
1045657981 8:104406529-104406551 CCCTGGGTATGTGGTGTGGGTGG - Intronic
1047217198 8:122885864-122885886 CCCTGGCTGTGTGGCCTAGTGGG + Intronic
1048522472 8:135169507-135169529 CCCAGGGTCTGGGGCATGGGAGG + Intergenic
1049018708 8:139939495-139939517 CCCTGGGAATGGGGACTGGGAGG - Intronic
1049411554 8:142475906-142475928 CCGTGGGAGTGGGGCCTAGCCGG + Intronic
1049532308 8:143160529-143160551 GCCTGGGTAGGGGGCCGCGGAGG - Exonic
1049707723 8:144050623-144050645 CCCTGGGTATCGCGCTTGGGGGG + Intergenic
1049707746 8:144050690-144050712 CCCTGGGTATCGTGCTTAGGGGG + Intergenic
1049755018 8:144307313-144307335 CTCTGGGAATGGGGCCCTGGAGG + Intronic
1055514293 9:77020668-77020690 CCCGGAGTATGGGGCCTTCGGGG + Exonic
1055872371 9:80897782-80897804 ACCTGGGTATGAGCCCCAGGTGG - Intergenic
1057034738 9:91803704-91803726 CCTTGCGTATGGGTCCTTGGGGG + Intronic
1057045574 9:91883876-91883898 CCCTGGGTAGGGGGCTGAGAAGG - Intronic
1057152954 9:92809927-92809949 CCCTGGGGCGGGGGCCTTGGAGG + Intergenic
1059467058 9:114475720-114475742 TCCTGGGTAAGGGGCCTGGTGGG - Intronic
1060104582 9:120865829-120865851 CCCTGGGCAAGGGGGCAAGGAGG + Exonic
1060400279 9:123344585-123344607 CCCTGGGCATGGGTCCTGGCAGG - Intergenic
1061719361 9:132542255-132542277 GCCAGGGGATGGGGCGTAGGCGG - Intronic
1190281481 X:48933982-48934004 CACTGGGCCTGGGGCCTAGTAGG - Intronic
1197621062 X:128749498-128749520 CCCTGGGAATGGGGCTTTGAAGG - Intergenic
1199322407 X:146455897-146455919 GCCTGGGCATGGAGCATAGGTGG - Intergenic
1200378145 X:155806098-155806120 CCCTGGGTCTGGGCCCTTGCTGG - Intergenic
1201918873 Y:19212719-19212741 GCCTGGGGAAGGGGCCTGGGTGG + Intergenic