ID: 1022515378

View in Genome Browser
Species Human (GRCh38)
Location 7:30971893-30971915
Sequence GGATTCTGGTGTGCTGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022515378_1022515387 28 Left 1022515378 7:30971893-30971915 CCAGTTGCAGCACACCAGAATCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1022515387 7:30971944-30971966 TTTCTCCCATTACCCCCAGGAGG 0: 1
1: 2
2: 39
3: 598
4: 818
1022515378_1022515386 25 Left 1022515378 7:30971893-30971915 CCAGTTGCAGCACACCAGAATCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1022515386 7:30971941-30971963 TCATTTCTCCCATTACCCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022515378 Original CRISPR GGATTCTGGTGTGCTGCAAC TGG (reversed) Intronic