ID: 1022515378

View in Genome Browser
Species Human (GRCh38)
Location 7:30971893-30971915
Sequence GGATTCTGGTGTGCTGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022515378_1022515387 28 Left 1022515378 7:30971893-30971915 CCAGTTGCAGCACACCAGAATCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1022515387 7:30971944-30971966 TTTCTCCCATTACCCCCAGGAGG 0: 1
1: 2
2: 39
3: 598
4: 818
1022515378_1022515386 25 Left 1022515378 7:30971893-30971915 CCAGTTGCAGCACACCAGAATCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1022515386 7:30971941-30971963 TCATTTCTCCCATTACCCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022515378 Original CRISPR GGATTCTGGTGTGCTGCAAC TGG (reversed) Intronic
902706753 1:18210718-18210740 GGCATCTGGTGTGCAGGAACCGG - Intronic
903516390 1:23913759-23913781 GGATCCTGGTGTGGGGCAATAGG + Intergenic
905951081 1:41951439-41951461 GATTTCTGGTGTGCTGAAATTGG + Intronic
910748091 1:90595723-90595745 GAATTCTGGAGAGCTGCAAAGGG + Intergenic
911138544 1:94470401-94470423 GGATTCTGTTGTGCAGCTCCAGG + Intronic
912457957 1:109811442-109811464 GGAATCTGCTGTGCTGCAAGAGG - Intergenic
913046396 1:115076859-115076881 GCATTCTGGTGGGCTGCCTCTGG - Intronic
914518192 1:148392088-148392110 GGCTTCAGGTATGCTTCAACTGG + Intergenic
1063240399 10:4163541-4163563 GGATACGGTTGTGCTGGAACGGG - Intergenic
1065078472 10:22104127-22104149 GCATTCTGGTGTGCTGCTATTGG - Intergenic
1066782033 10:38961431-38961453 GGGTTTTGGAGTGTTGCAACTGG + Intergenic
1067197439 10:44134322-44134344 ATATTATGGTGGGCTGCAACTGG + Intergenic
1067761300 10:49049079-49049101 GGGTTCTGGGGAGCTGCACCTGG + Intronic
1070705643 10:78636012-78636034 GGTGTCAGGTGTGCTGAAACTGG + Intergenic
1071712886 10:88067008-88067030 TGAAACTCGTGTGCTGCAACAGG + Intergenic
1071927522 10:90427757-90427779 GGATTCTGATGTGATGCCTCAGG + Intergenic
1079960053 11:26912949-26912971 GTACACTGGTGTGCTGTAACTGG - Intergenic
1080223390 11:29933411-29933433 GGATTCTGGGATTCTACAACAGG - Intergenic
1090534350 11:127624420-127624442 GGATTCTGCTTTGTTGCAGCTGG - Intergenic
1090955738 11:131511653-131511675 TCATTCTGGTGTCCTGCAACTGG - Intronic
1098241773 12:68474592-68474614 GGATCCTGCTTTGCTGCATCCGG + Intergenic
1098277111 12:68823931-68823953 TGCTTGTGGTGTCCTGCAACAGG + Intronic
1100335292 12:93623506-93623528 CCATGCTGGTGTGCTGCACCGGG + Intergenic
1101587582 12:106098548-106098570 GCATTGTGATGTGCTGGAACTGG - Intronic
1106603944 13:31210224-31210246 GAATTCTGGTAAACTGCAACAGG - Intronic
1111184174 13:84709371-84709393 GGATTTTGGCATGCTGCAATGGG - Intergenic
1111723911 13:91980748-91980770 GGATCCTGGTGTGCTGGTAATGG - Intronic
1113764030 13:112869735-112869757 GGAGGCTGCTGTGCTGTAACTGG - Intronic
1116677411 14:47923604-47923626 GAATTCTGGTGTGGTGCAAAGGG - Intergenic
1117201588 14:53395262-53395284 GGATTCTGTTGTTCAGCAACTGG + Intergenic
1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG + Intronic
1121726723 14:96157655-96157677 GGGTTGTGGTGTGCTGCAGGTGG - Intergenic
1121738197 14:96233499-96233521 GGAGTCTGGTGTCCTGCTTCAGG + Intronic
1125873415 15:43123055-43123077 CGATGCTGGTGAGCTGGAACTGG - Intronic
1126990273 15:54366893-54366915 GTATCCTGCTGTGCTGTAACAGG - Intronic
1133500004 16:6357022-6357044 TGATTCTGCTGTCCTGCACCCGG + Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1133974609 16:10591694-10591716 GGAGTCTGGAGTGCTGCCACGGG - Intergenic
1140881315 16:79200355-79200377 TGATTCTGGGGTGCTACAAAGGG + Intronic
1141739922 16:85884325-85884347 GGATGCAGATGTGCAGCAACTGG - Intergenic
1142354807 16:89597334-89597356 GGATCCTGGTGTGCTGGGCCTGG - Intergenic
1142569350 17:862759-862781 GGCTCCTGGTGAGATGCAACAGG + Intronic
1143355028 17:6321298-6321320 GGAGTCTTGTGTGCTGCTGCAGG + Intergenic
1144952647 17:19002474-19002496 GCATTCTGGTCTTCTGCAATTGG + Intronic
1150219205 17:63486628-63486650 TGATAGTGGTGTTCTGCAACTGG - Exonic
1153090988 18:1342502-1342524 AGTCTCTGGTGTGCTGCTACTGG + Intergenic
1156013166 18:32517252-32517274 GGATTCTGTTTTGCTGTAATTGG + Intergenic
1159700384 18:71619038-71619060 GGATGATGGTTTGCTGAAACTGG + Intergenic
1160105490 18:75970569-75970591 GGATCATGGTGTCCTGCCACCGG + Intergenic
1160367314 18:78337508-78337530 GGATGCAGGTGCGCTGGAACTGG - Intergenic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1168693633 19:58392839-58392861 GGATCCTGGTATGCCTCAACAGG - Intronic
926784022 2:16502474-16502496 GGAGTCTAGTGAGCTGCAAGTGG + Intergenic
929528173 2:42725770-42725792 GGATTCTGCAGTGCTGGAGCAGG - Intronic
929920483 2:46167904-46167926 GGAGCCTGCTGTGCTGGAACAGG - Intronic
930113914 2:47702432-47702454 GCATTTTGGTCTGCTACAACAGG - Intronic
937445387 2:121952995-121953017 GGATGCAGCTCTGCTGCAACAGG + Intergenic
938692759 2:133807543-133807565 GTTTTCTGCTGTGCTGCAGCTGG - Intergenic
940721130 2:157283434-157283456 GTATTCAGGTGGGTTGCAACTGG - Intronic
944615395 2:201453798-201453820 GGAGTTTGCTGTGCTGCAAAAGG - Intronic
1178351054 21:31873393-31873415 GGATCCTGGTGTCCTGAAAGGGG + Exonic
1180185033 21:46135273-46135295 GGATGCTGGTGTGGTGTAATTGG - Intergenic
949938169 3:9133549-9133571 GAATTCTAGTGTGCTGTAAAAGG - Intronic
950679196 3:14573418-14573440 GGATCCTGGTGTGCAGGAAGAGG + Intergenic
952595627 3:35014410-35014432 CCATGCTGGTGTGCTGCACCCGG + Intergenic
956694121 3:71904234-71904256 GGACTGGGGTGTGCTGCCACAGG + Intergenic
958091322 3:88880166-88880188 AGATTTTGGGGTGCAGCAACTGG + Intergenic
959833556 3:110892555-110892577 GGGTTCCGGTGTGATGCATCAGG - Exonic
963063860 3:141246948-141246970 GGACTCTGGTGAGCTGAGACAGG - Intronic
963717568 3:148821516-148821538 GGCTTGTGGTGTGCTGTAATTGG - Intronic
969352181 4:6604239-6604261 AGACTCTTGTCTGCTGCAACTGG - Intronic
971310722 4:25523649-25523671 GGATTCTGCTTTGCTCCAGCAGG + Intergenic
971448836 4:26780648-26780670 GGCTTCTGGTCTCCTGCAACTGG + Intergenic
975243887 4:72095235-72095257 GTCTGCTGGTGTGCTGGAACTGG + Intronic
975476212 4:74826155-74826177 GGATTCTGTAGTGATGAAACCGG + Intergenic
976830854 4:89312241-89312263 GGATTCTGGAGGGCTGCCATTGG + Intergenic
981364847 4:143890578-143890600 GGATTCTGATGTGCGGCCAGCGG + Intronic
984471244 4:180177147-180177169 AGATTCTGGTATGTTGAAACAGG - Intergenic
986693983 5:10335896-10335918 TGCCTCTGGTGTGCTGCAGCAGG + Intergenic
992189382 5:74276240-74276262 GGCTTCTGGTGGTCTGCATCAGG - Intergenic
994455230 5:99997352-99997374 GGAGTCTGGTGTTCTGAAACTGG + Intergenic
995315674 5:110769514-110769536 GGCTTATGATGTGATGCAACTGG + Intergenic
997264217 5:132485775-132485797 GGGATCTGGTGGGCTGGAACTGG - Intronic
998489966 5:142538113-142538135 GTCTTCTGATGTGATGCAACAGG + Intergenic
999298413 5:150475040-150475062 GGATTCTGCTGTGCAGACACTGG + Intergenic
1003844513 6:10159118-10159140 GGCATCTGGTGTGCTGCGCCAGG + Intronic
1005764243 6:28995273-28995295 GGATTCTTTTGTGCTGCCTCAGG + Exonic
1008511035 6:52276082-52276104 GGATTCTGCTGTGCAGGAATGGG + Intronic
1014075683 6:117231618-117231640 GGAGTCTGGTGGGAGGCAACTGG - Intergenic
1017247211 6:152239571-152239593 GGCTTCTGCTGTACTGAAACGGG - Exonic
1017253720 6:152309855-152309877 GGATGGCGGTGTGCTGCAGCCGG + Exonic
1020164435 7:5796942-5796964 AGGTTCTGGTGTGCTCCAGCTGG - Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1031403421 7:121353634-121353656 GGAGTCTGGTATTTTGCAACAGG + Intronic
1037316318 8:17602790-17602812 GGTTTCAGCTGTGCTACAACTGG + Intronic
1038191747 8:25328078-25328100 GCATTCTGGTCTTCTGCAGCTGG + Intronic
1044789618 8:95834335-95834357 GGATTCAGGTGTGCTCCATATGG + Intergenic
1048969823 8:139639238-139639260 GGATTCTGGTGAGCATCAATGGG - Intronic
1049747884 8:144270673-144270695 GGATTCGGGTGGGCTGCCGCAGG - Intronic
1052050507 9:23842422-23842444 GGAGGCTGGTTTTCTGCAACAGG - Intergenic
1055494395 9:76840380-76840402 GCATGCTGGTGTGCTGTAAATGG - Intronic
1056164964 9:83932222-83932244 GCCTCCTGGTGTGTTGCAACAGG - Intergenic
1056770965 9:89478157-89478179 GCCTTCTTGTGTGCTGTAACAGG + Intronic
1191641174 X:63430916-63430938 GGCTTCTGGAGTGTTGCCACGGG + Intergenic