ID: 1022515386

View in Genome Browser
Species Human (GRCh38)
Location 7:30971941-30971963
Sequence TCATTTCTCCCATTACCCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 221}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022515380_1022515386 4 Left 1022515380 7:30971914-30971936 CCCCTCTCCCTGCTTGCTTCTTG 0: 1
1: 1
2: 4
3: 92
4: 906
Right 1022515386 7:30971941-30971963 TCATTTCTCCCATTACCCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 221
1022515382_1022515386 2 Left 1022515382 7:30971916-30971938 CCTCTCCCTGCTTGCTTCTTGTT 0: 1
1: 1
2: 3
3: 65
4: 586
Right 1022515386 7:30971941-30971963 TCATTTCTCCCATTACCCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 221
1022515383_1022515386 -3 Left 1022515383 7:30971921-30971943 CCCTGCTTGCTTCTTGTTCCTCA 0: 1
1: 0
2: 0
3: 37
4: 432
Right 1022515386 7:30971941-30971963 TCATTTCTCCCATTACCCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 221
1022515384_1022515386 -4 Left 1022515384 7:30971922-30971944 CCTGCTTGCTTCTTGTTCCTCAT 0: 1
1: 0
2: 3
3: 45
4: 496
Right 1022515386 7:30971941-30971963 TCATTTCTCCCATTACCCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 221
1022515377_1022515386 26 Left 1022515377 7:30971892-30971914 CCCAGTTGCAGCACACCAGAATC 0: 1
1: 0
2: 1
3: 7
4: 105
Right 1022515386 7:30971941-30971963 TCATTTCTCCCATTACCCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 221
1022515378_1022515386 25 Left 1022515378 7:30971893-30971915 CCAGTTGCAGCACACCAGAATCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1022515386 7:30971941-30971963 TCATTTCTCCCATTACCCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 221
1022515379_1022515386 11 Left 1022515379 7:30971907-30971929 CCAGAATCCCCTCTCCCTGCTTG 0: 1
1: 0
2: 1
3: 43
4: 413
Right 1022515386 7:30971941-30971963 TCATTTCTCCCATTACCCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 221
1022515381_1022515386 3 Left 1022515381 7:30971915-30971937 CCCTCTCCCTGCTTGCTTCTTGT 0: 1
1: 0
2: 2
3: 57
4: 674
Right 1022515386 7:30971941-30971963 TCATTTCTCCCATTACCCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022515386 Original CRISPR TCATTTCTCCCATTACCCCC AGG Exonic
900682374 1:3924073-3924095 TGATTTCTCCCATGTCCCCGTGG - Intergenic
901407270 1:9057726-9057748 TCCTGCCTCCCATCACCCCCCGG - Intronic
901664995 1:10820790-10820812 TCATTTCACACCGTACCCCCAGG - Intergenic
902614568 1:17616735-17616757 TCATTTCCTCCATGCCCCCCAGG - Intronic
905923301 1:41733130-41733152 TCTTTTCTGTCATTGCCCCCAGG + Intronic
907077948 1:51595108-51595130 TCATTATTCTCACTACCCCCAGG - Intronic
908500069 1:64734191-64734213 TCATTTCTCACATTCCACTCGGG + Intergenic
911580203 1:99625321-99625343 TCATTCATCCCAGTTCCCCCAGG + Intergenic
911737760 1:101356026-101356048 TCATTTGTGCCATTTTCCCCAGG - Intergenic
912595572 1:110872548-110872570 TCATTTCTACCAGTGCCCCTGGG + Intergenic
917412390 1:174772741-174772763 TCCTTTCTCCCCTTAGCCCCTGG + Intronic
917472193 1:175335334-175335356 TCATTTCTCCCCTGACCTGCAGG + Intronic
917528800 1:175814336-175814358 TCATGTCTGCCTCTACCCCCCGG - Intergenic
919986905 1:202681806-202681828 TCATGTCTCCCAGCACCGCCTGG + Intronic
920577651 1:207073310-207073332 TCTTTTCTCCCATGACTCTCAGG + Exonic
921003556 1:211069177-211069199 TCATTCCTCCCCTCACCCCTTGG - Intronic
922479222 1:225927257-225927279 GCAGTTCTCCCATTTCACCCTGG - Intergenic
923119323 1:230976406-230976428 TCATTTCTCCCTCTTCGCCCTGG - Intronic
923255286 1:232216635-232216657 TAATCTCTGCCATTACCCCCAGG - Intergenic
924927031 1:248693137-248693159 ACATTTCTCCCATTGCTGCCAGG + Intergenic
1062935358 10:1381831-1381853 TCCTTTCTCCCCTCACCCCATGG - Intronic
1064280163 10:13944216-13944238 CCATTGCTCACATTACCACCTGG + Intronic
1067667294 10:48289215-48289237 TCATCTCTCCCACTACTCACGGG + Intergenic
1070051827 10:72896942-72896964 TCATTGCTCCCCTTAACTCCAGG - Intronic
1070141722 10:73743138-73743160 TCAGTTCTGCCATTCCACCCAGG - Intergenic
1072054338 10:91739751-91739773 TCATTTCTGCCATTTCAGCCTGG + Intergenic
1072310361 10:94148456-94148478 TCATTTCTTCCATTCACACCTGG + Intronic
1073023514 10:100468024-100468046 ACATTTCTCCCATTGCCCTTAGG + Intronic
1073441942 10:103557386-103557408 TCATTTGTCCCATTTCCCTGGGG + Intronic
1074414436 10:113254940-113254962 TTAGTACTCCCATTACACCCTGG + Intergenic
1075265887 10:120999346-120999368 TGTTTCCTCCCTTTACCCCCTGG - Intergenic
1075559623 10:123459116-123459138 TCATTTCTGCTTTTACCCCCTGG + Intergenic
1075680262 10:124326226-124326248 TCAACTCTCCCTGTACCCCCAGG - Intergenic
1075882622 10:125866770-125866792 CCATGACTCCCATTATCCCCTGG - Intronic
1077922540 11:6652518-6652540 TCCTTTCTCCCATTCCTCCTGGG - Intronic
1080764839 11:35286268-35286290 TAATTTCTGCCATTACCCTCTGG + Intronic
1081727525 11:45341501-45341523 TCAGTTCTCCCGCTAACCCCTGG - Intergenic
1083213935 11:61206796-61206818 TCACTCATCCCTTTACCCCCTGG - Intronic
1083216819 11:61225625-61225647 TCACTCATCCCTTTACCCCCTGG - Intronic
1083219701 11:61244451-61244473 TCACTCATCCCTTTACCCCCTGG - Intronic
1083754373 11:64782407-64782429 TCACTTCTGCCTTTACCTCCTGG - Intergenic
1084488473 11:69464579-69464601 TTATTTCTCTCTGTACCCCCCGG - Intergenic
1084870707 11:72096970-72096992 CCATGTCTCCCTTCACCCCCAGG + Intronic
1085239216 11:75038194-75038216 TCCTGTCTCCCCTTAGCCCCTGG + Intergenic
1085479346 11:76808408-76808430 TCAATTCTCCCATCAAGCCCCGG - Intergenic
1086179193 11:83930171-83930193 TAATTTCTCCCATTGCACCAAGG + Intronic
1087296186 11:96376998-96377020 TGCTTTCTCCCACAACCCCCAGG + Intronic
1087953521 11:104255136-104255158 TTACTTCTCACATTACTCCCTGG - Intergenic
1091773934 12:3172149-3172171 TCATTTCTCCTCTTCCTCCCTGG + Intronic
1093559089 12:20516118-20516140 TCACTTCTCCCATTACCTTTGGG - Intronic
1094222661 12:28011051-28011073 TCATTTCTACCATCTCCCCAAGG + Intergenic
1095578568 12:43767905-43767927 TCATTTGTCCAATTATCCTCTGG - Intronic
1095722276 12:45413586-45413608 TCAAATGTCCCTTTACCCCCGGG - Intronic
1096071598 12:48778409-48778431 ATATCTCTCCCATTACCCACAGG + Intronic
1097772339 12:63602551-63602573 TAATTTTTTCCAGTACCCCCTGG - Intronic
1099821457 12:87716580-87716602 TCATTTGACCCATTCCACCCTGG + Intergenic
1100660861 12:96697335-96697357 CCATTTTTCTCATTACCCCTAGG - Intronic
1102019726 12:109673899-109673921 TAATTTCTATCATTACCCCATGG - Intergenic
1104352595 12:128057819-128057841 TCATTTCTCCCACAATCCCTTGG + Intergenic
1108907806 13:55500896-55500918 TCATTTATGCCATTGCCCACGGG + Intergenic
1109218855 13:59620392-59620414 TAATTTCTTCCTTTACCCACTGG - Intergenic
1110616771 13:77550523-77550545 TCACCTCTCCCCTTAACCCCTGG + Intronic
1111610466 13:90599925-90599947 TCATTTCTCACATCACAACCTGG - Intergenic
1114491064 14:23102306-23102328 TCCTTTCTTCCATCACCCCAAGG + Intergenic
1114593874 14:23894466-23894488 TCAATTCTCCCATCACTGCCAGG + Intergenic
1115550696 14:34502523-34502545 TAATTGCTCCTATTACCTCCTGG - Intergenic
1119087374 14:71750756-71750778 TCAATTGTCCCATTATCCCTTGG + Intergenic
1123430286 15:20209210-20209232 ACATTTCTCCCAGTACCTTCTGG - Intergenic
1126104660 15:45139538-45139560 GCTTGTCTCCCATTACCCGCTGG + Exonic
1126976614 15:54189259-54189281 TCATTTCTCCCTTTTGCCCAGGG - Intronic
1127215932 15:56823085-56823107 TCATTTCTTCCATAATCCCTTGG + Intronic
1128615116 15:69102898-69102920 CCATGTCTCCCATCAGCCCCAGG + Intergenic
1129096128 15:73210290-73210312 TCATTTCTGCATTTACTCCCAGG + Intronic
1131301354 15:91202474-91202496 TCATTTTTCCCAAGACACCCAGG - Intronic
1131591808 15:93757511-93757533 CCTGTTCTCCCACTACCCCCAGG - Intergenic
1132047633 15:98578052-98578074 TCATTGCAGCCATTACCCCCTGG - Intergenic
1132208673 15:100004354-100004376 TCATTTCACCCAACCCCCCCTGG + Intronic
1133973126 16:10580875-10580897 CCCTTTCTCCCTTTTCCCCCGGG - Intergenic
1135507081 16:23048400-23048422 CCCTTTGTCCCATTACCACCAGG - Intergenic
1135533977 16:23278551-23278573 TCCCGTCTCCCACTACCCCCTGG - Intronic
1135627366 16:24007794-24007816 TGATTTCTCCATTTGCCCCCAGG - Intronic
1136241746 16:28948888-28948910 TCTTGTCTCCCATTTCCCCTAGG - Intergenic
1136854349 16:33641996-33642018 ACATTTCTCCCAGTACCTTCTGG + Intergenic
1138459425 16:57139268-57139290 TCAGTTCTGCCATTGCACCCAGG - Intronic
1138625816 16:58250337-58250359 TCACTTCCCCAATTACCCTCTGG - Intronic
1138744936 16:59352547-59352569 TCAGTTCTGCCATTGCACCCAGG - Intergenic
1138926058 16:61592715-61592737 TCAATTGTCTCAGTACCCCCAGG + Intergenic
1139672614 16:68502011-68502033 TCATTTCTCACAATAGCCCCAGG - Intergenic
1141290493 16:82714133-82714155 TCATTTCTCCCAGCAGCCACAGG + Intronic
1141811356 16:86378424-86378446 TCATTTGTCCCAGCAGCCCCAGG - Intergenic
1141980971 16:87550441-87550463 TCATTCCTCCCAGTCCCCCGTGG - Intergenic
1203115926 16_KI270728v1_random:1490446-1490468 ACATTTCTCCCAGTACCTTCTGG + Intergenic
1142941590 17:3384202-3384224 TCTTTTCTCCCATTGCTCCAAGG - Intergenic
1143096967 17:4483346-4483368 TTATTTCTGAAATTACCCCCTGG + Intronic
1145092641 17:19998657-19998679 TCATCTCCCCTGTTACCCCCTGG - Intergenic
1145964476 17:28907041-28907063 TCCTCTCTCCCCTTAGCCCCAGG - Intronic
1146279508 17:31536120-31536142 TCATTTCTCCCAGTTTCACCTGG - Exonic
1148868640 17:50642609-50642631 TCATCACTCCCATTACTCACAGG + Intronic
1150340537 17:64363095-64363117 TCCTTTCTCCCATTCAACCCTGG + Intronic
1150727252 17:67661449-67661471 CCCTTTCTCCCCTCACCCCCAGG + Intronic
1151545579 17:74790993-74791015 CCATTTGTCCCATTTCCACCCGG - Exonic
1153707297 18:7758882-7758904 TCATTTCTCCCCTGAACCCAGGG + Intronic
1153836025 18:8964838-8964860 TCCTTTCTCCCGCTACCCACTGG - Intergenic
1153945553 18:10014196-10014218 TCACCTCTCCCATCACACCCAGG + Intergenic
1154225639 18:12501265-12501287 TCTTCTCTCCCCTTATCCCCTGG - Intronic
1155594611 18:27470469-27470491 TCCTTATTACCATTACCCCCAGG + Intergenic
1156371801 18:36477695-36477717 TTATGTCTCCCATTAACACCTGG - Intronic
1156733865 18:40229213-40229235 TCCCGTCTCCCACTACCCCCTGG + Intergenic
1157288861 18:46395818-46395840 TCCTTCCTCCCATCACCACCTGG - Intronic
1158578701 18:58662541-58662563 TCCCTTCTCCCACTAGCCCCTGG + Intergenic
1162898321 19:13778630-13778652 TCTTTTCTCCATTTAACCCCGGG + Intergenic
1166124715 19:40707318-40707340 TCATTTCCCCCAATCTCCCCAGG + Intronic
1166257697 19:41618325-41618347 TCAGTTCCCACTTTACCCCCTGG - Intronic
1166283940 19:41811991-41812013 TCAGTTCCCACTTTACCCCCTGG + Intergenic
1166578976 19:43875526-43875548 TTATTTTTCCCAATATCCCCAGG - Intronic
1167012955 19:46821041-46821063 TCATCTCTCCCATCTCCACCTGG + Intergenic
1167552676 19:50171964-50171986 TCCTCTCTCCCACTAGCCCCTGG + Intergenic
925263846 2:2550775-2550797 TCATTTCTCCTATTTCTCCTGGG - Intergenic
926053228 2:9757811-9757833 TCATTTTTCCAATTATTCCCAGG - Intergenic
927709404 2:25315333-25315355 TCCTTCCTCCCACTACCCCCTGG - Intronic
928485491 2:31727148-31727170 TCCATTCTCCCCTTAACCCCTGG - Intergenic
928607352 2:32954887-32954909 TCATCTCTCCTAACACCCCCTGG - Intronic
931177619 2:59869798-59869820 TCATTTCTCCCTGTGCCCCTAGG - Intergenic
932179221 2:69630772-69630794 TCTTTCCTCCCCTTCCCCCCTGG - Intronic
932332544 2:70905914-70905936 CCATTTCCCCAATTACCCCTTGG + Intronic
938861765 2:135376684-135376706 TCATTTATTCAATTTCCCCCAGG - Intronic
943555025 2:189392601-189392623 TCCTTCATCCCATTACTCCCAGG + Intergenic
944213685 2:197232474-197232496 TTATTTCTCCCATTTCTACCTGG - Intronic
944416518 2:199484799-199484821 TCATTGCTACCATTTTCCCCAGG + Intergenic
945308157 2:208280113-208280135 TCAGAGCTCCCATTACCCTCAGG + Intronic
946853191 2:223927915-223927937 TCCTTTCCCCCTTTCCCCCCAGG - Intronic
948884188 2:240874786-240874808 TCATTTCTCACATCACCCAAAGG - Intronic
1169040389 20:2489655-2489677 TCATTTCTCACATTACCTCTTGG - Intronic
1169255361 20:4092575-4092597 TAAGTTCACCCATTACCTCCAGG - Intergenic
1170776938 20:19383384-19383406 TTTTTTTTCCCACTACCCCCAGG + Intronic
1172598956 20:36170528-36170550 TCATTTCTCTCACTAGCCCCTGG + Intronic
1173979491 20:47212216-47212238 CCATTTCTTCCAGTACCCGCTGG - Intronic
1174837198 20:53867910-53867932 TCATTTCTCCCATTGTGCCCTGG + Intergenic
1175556292 20:59860080-59860102 TCGTTTCTCCCATTCCCACTTGG + Intergenic
1175693699 20:61085143-61085165 TCATTTCTTCCATATCCCCCTGG - Intergenic
1181921311 22:26322590-26322612 ACTTTTCTCCCATTAACTCCGGG - Intronic
1183652651 22:39167321-39167343 TCAGTTCTCTCCTTTCCCCCTGG - Intergenic
1184904592 22:47472461-47472483 TCATTTCTACCATCACACCTGGG + Intronic
949645819 3:6092755-6092777 TGATCTTTCCCATTAGCCCCTGG + Intergenic
949727161 3:7062539-7062561 TAATTTCTCCAATCACCCCCAGG + Intronic
950257253 3:11515600-11515622 TCAATTCTGTCATTACCCCTGGG - Intronic
950481541 3:13247349-13247371 TCATTTCCTCCATTGCCCCCAGG + Intergenic
952397558 3:32934392-32934414 TCTTTCCCCCCATTCCCCCCAGG - Intergenic
952911117 3:38187550-38187572 TCATTTCTACCATTACTTTCTGG - Intronic
953899105 3:46829087-46829109 TCATTTCCCTCATTACCCTATGG - Intergenic
954295759 3:49673915-49673937 TCATTGGTCCCATTCCCCTCGGG + Intergenic
955122592 3:56075662-56075684 TCATTTCTCCCTGAACCTCCAGG + Intronic
955227153 3:57070124-57070146 TCAATTCTCCTATCACCACCTGG + Intronic
955587464 3:60496406-60496428 TCATTTCTCCAATTATCCAGTGG - Intronic
956322129 3:68008499-68008521 TAATTTCTCCCCTTTCGCCCAGG + Intronic
957670660 3:83297238-83297260 TCATGCCCCCCATTTCCCCCAGG - Intergenic
961222000 3:125208401-125208423 TCATTTATACCACTACCCCCTGG + Intronic
961464466 3:127072887-127072909 TCAGTTCTCCCATTTCTCCTGGG - Intergenic
961935094 3:130574603-130574625 TAAATTCTCCCACTAGCCCCAGG - Intronic
964624130 3:158742717-158742739 TCACTTCTTCCATAGCCCCCAGG - Intronic
965068612 3:163886374-163886396 TCATTTCTCCCAATAGCCTTGGG + Intergenic
967094313 3:186164100-186164122 TCTTTTCTCCCAGAACCTCCTGG - Intronic
967535943 3:190603747-190603769 TCCTTTCTCCCATTTGCCCAAGG + Intronic
968981634 4:3853366-3853388 TTAATTCTCCCATCACCCCCAGG + Intergenic
969170632 4:5359844-5359866 TCATGTCTCACCTTTCCCCCTGG - Intronic
970695919 4:18676875-18676897 TCATTTCTGACATCTCCCCCAGG - Intergenic
972882252 4:43439373-43439395 TCATTTCTCTCCTAACCCACAGG - Intergenic
978424765 4:108570564-108570586 TCAGTTCTGCCATCTCCCCCGGG - Intergenic
978576480 4:110195501-110195523 GCATTTCTCCCAATATCCCAGGG - Intronic
979070509 4:116198433-116198455 TTATTTATTCCATTGCCCCCTGG - Intergenic
980007318 4:127557940-127557962 TCATTCCTCTCTTTAGCCCCTGG - Intergenic
981259644 4:142704560-142704582 TCATTCCTCCCATTACCATGGGG + Intronic
984181553 4:176489322-176489344 TCAATTCTCTCCCTACCCCCAGG - Intergenic
986952077 5:13101001-13101023 TCATTACTCACATTACCGCCTGG + Intergenic
989207809 5:38828989-38829011 ACCTGTATCCCATTACCCCCAGG + Intergenic
989539135 5:42598403-42598425 AAATTTCACCCATTATCCCCAGG - Intronic
991047523 5:62238185-62238207 ACATTTCTCCCAGTACCTTCTGG - Intergenic
992593546 5:78321870-78321892 TCATTTCTGCCTTTACTCTCAGG - Intergenic
992771245 5:80050429-80050451 TCATTTCTGCCATCACACCCAGG - Intronic
992948914 5:81837701-81837723 TCCTTCCTCTCATTGCCCCCTGG + Intergenic
993048820 5:82900667-82900689 TCATGTCTCACATTAACACCAGG - Intergenic
993634230 5:90325268-90325290 TCATTTCTGCCATTTCAGCCTGG + Intergenic
993869005 5:93227852-93227874 TCCTTTCTCCCAGAAGCCCCTGG + Intergenic
995484581 5:112627358-112627380 AATTTTCTCCCTTTACCCCCAGG - Intergenic
996583197 5:125054512-125054534 CAGTGTCTCCCATTACCCCCAGG + Intergenic
999217735 5:149949599-149949621 TTACTTCTCCCACTATCCCCTGG + Intergenic
999583312 5:153063276-153063298 TGATTTCTCCCATTACTATCTGG + Intergenic
1000132475 5:158313379-158313401 CCATTTGTCCCATTTCACCCAGG - Intergenic
1005445725 6:25920606-25920628 TGATTTCTCTCCTTACCACCTGG + Intronic
1008490570 6:52082618-52082640 TAATGTCTTACATTACCCCCAGG - Intronic
1009608375 6:65904165-65904187 TCATTTCACCCATTTCAGCCAGG - Intergenic
1009858386 6:69293106-69293128 TCTTTTGTCCCCTTGCCCCCTGG - Intronic
1010632749 6:78218325-78218347 TCATTTCTCCCAGTTCCCAGAGG + Intergenic
1013269441 6:108532319-108532341 TCATTCCTGCCCTCACCCCCAGG - Intergenic
1014137448 6:117906815-117906837 TTTTTTCTCCCATTTCCACCAGG + Intergenic
1014661601 6:124179652-124179674 CCATTTCACCCATTACCCATGGG + Intronic
1015797972 6:137032190-137032212 ACATTTCTTACATTTCCCCCAGG - Intronic
1015889427 6:137954951-137954973 CCATTTCTCCAATTATTCCCAGG + Intergenic
1017216670 6:151916027-151916049 TCATTTCACCAATTACCAACTGG - Intronic
1022515386 7:30971941-30971963 TCATTTCTCCCATTACCCCCAGG + Exonic
1022765841 7:33410435-33410457 TCACCTCTCCCATTTCTCCCAGG + Intronic
1022931905 7:35126264-35126286 TAATTTTTTCCAGTACCCCCTGG - Intergenic
1023134749 7:37040290-37040312 TCATTTTCCTGATTACCCCCAGG + Intronic
1024414163 7:49082783-49082805 GCATGTTCCCCATTACCCCCTGG + Intergenic
1024488755 7:49952050-49952072 TCATGTCTACCATTACCCCCTGG - Intronic
1029827792 7:103218742-103218764 TAATTTTTTCCAGTACCCCCTGG - Intergenic
1032060019 7:128716404-128716426 TCATTTCTGCCAATCCTCCCTGG - Intronic
1032260959 7:130336951-130336973 TAGTTTCTTCCTTTACCCCCTGG + Intergenic
1037694985 8:21215721-21215743 TCATTTGTGCCATTACCTCCAGG - Intergenic
1037904548 8:22708019-22708041 TAATTTTTCCACTTACCCCCAGG - Intergenic
1039667609 8:39552500-39552522 TCATTTCTTATATTAACCCCTGG - Intergenic
1039784112 8:40817416-40817438 TCATTTTTCCCAATGACCCCTGG - Intronic
1041982739 8:63881739-63881761 TCAAATCTCCCCTTACCACCTGG - Intergenic
1042030764 8:64472904-64472926 TCTTTTCTCCCTTTAGCTCCAGG - Intergenic
1042872597 8:73412003-73412025 TCATGTCACTCATTACCACCCGG + Intergenic
1043305584 8:78789988-78790010 ACATTTCTCCCATTAACTCTAGG - Intronic
1044190699 8:89313418-89313440 TCATGTTTCCCATTACCAACTGG + Intergenic
1044532271 8:93320959-93320981 TCATTTCTCTCTTTCCTCCCAGG + Intergenic
1045828825 8:106433249-106433271 TCAGTTCTGCCATCACACCCAGG - Intronic
1046255581 8:111693232-111693254 TCATTTCAGCCATTCCCGCCTGG + Intergenic
1050042995 9:1515060-1515082 TCACTTTCCCCATTACCCCAAGG + Intergenic
1051380654 9:16455071-16455093 TCATTTCTCACATTTGCACCTGG - Intronic
1052619151 9:30883131-30883153 TCATTTCAGCCATTACTGCCTGG + Intergenic
1052634594 9:31085888-31085910 GCAGTTCTACCATTACTCCCTGG - Intergenic
1053308606 9:37001375-37001397 TCTTTTCTCCCATTGTCACCTGG - Intronic
1054763540 9:69024171-69024193 TCCTTTCTCCCTTTCCCCTCTGG - Intergenic
1055613808 9:78050581-78050603 TCATTTCCACAATTACCCCTTGG + Intergenic
1057930393 9:99188483-99188505 GCCTCTCTCCCATTCCCCCCAGG + Intergenic
1059870092 9:118563293-118563315 TCCTCTCTCCTATTGCCCCCTGG + Intergenic
1061819118 9:133214714-133214736 TTATTTCTCCCTTTCCCACCAGG - Intergenic
1062241567 9:135543473-135543495 TTATTTCTCCCTTTCCCACCAGG + Intergenic
1185928467 X:4173313-4173335 TCATGTCTCCCATCACCCCCAGG + Intergenic
1186739217 X:12499525-12499547 TCCTCCCTCCCCTTACCCCCTGG + Intronic
1186861019 X:13672611-13672633 TCTTTTCTCCCACCAGCCCCAGG - Intronic
1188121175 X:26309945-26309967 TCAGTTCTGCCATCACACCCAGG - Intergenic
1188993661 X:36855220-36855242 TAATTTGTCCCATTACCACCTGG - Intergenic
1190604616 X:52127657-52127679 TCATTTCTGCCATTTCAGCCTGG - Intergenic
1191141059 X:57117310-57117332 TCAGTTCTCCCATTGCCTTCAGG + Intergenic
1191142659 X:57133026-57133048 TCAGTTCTCCCATTGCCTTCAGG + Intergenic
1193827664 X:86245820-86245842 TCATTTCTGCCATTTCAGCCTGG - Intronic
1196410714 X:115415220-115415242 GCAATTCTCCCATGACCCCAGGG - Intergenic
1198644558 X:138791807-138791829 ACATTTCTCAACTTACCCCCAGG + Intronic
1198834959 X:140795255-140795277 TCATTTCTCCCATTAGGAACGGG - Intergenic