ID: 1022515387

View in Genome Browser
Species Human (GRCh38)
Location 7:30971944-30971966
Sequence TTTCTCCCATTACCCCCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1458
Summary {0: 1, 1: 2, 2: 39, 3: 598, 4: 818}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022515379_1022515387 14 Left 1022515379 7:30971907-30971929 CCAGAATCCCCTCTCCCTGCTTG 0: 1
1: 0
2: 1
3: 43
4: 413
Right 1022515387 7:30971944-30971966 TTTCTCCCATTACCCCCAGGAGG 0: 1
1: 2
2: 39
3: 598
4: 818
1022515381_1022515387 6 Left 1022515381 7:30971915-30971937 CCCTCTCCCTGCTTGCTTCTTGT 0: 1
1: 0
2: 2
3: 57
4: 674
Right 1022515387 7:30971944-30971966 TTTCTCCCATTACCCCCAGGAGG 0: 1
1: 2
2: 39
3: 598
4: 818
1022515377_1022515387 29 Left 1022515377 7:30971892-30971914 CCCAGTTGCAGCACACCAGAATC 0: 1
1: 0
2: 1
3: 7
4: 105
Right 1022515387 7:30971944-30971966 TTTCTCCCATTACCCCCAGGAGG 0: 1
1: 2
2: 39
3: 598
4: 818
1022515380_1022515387 7 Left 1022515380 7:30971914-30971936 CCCCTCTCCCTGCTTGCTTCTTG 0: 1
1: 1
2: 4
3: 92
4: 906
Right 1022515387 7:30971944-30971966 TTTCTCCCATTACCCCCAGGAGG 0: 1
1: 2
2: 39
3: 598
4: 818
1022515383_1022515387 0 Left 1022515383 7:30971921-30971943 CCCTGCTTGCTTCTTGTTCCTCA 0: 1
1: 0
2: 0
3: 37
4: 432
Right 1022515387 7:30971944-30971966 TTTCTCCCATTACCCCCAGGAGG 0: 1
1: 2
2: 39
3: 598
4: 818
1022515384_1022515387 -1 Left 1022515384 7:30971922-30971944 CCTGCTTGCTTCTTGTTCCTCAT 0: 1
1: 0
2: 3
3: 45
4: 496
Right 1022515387 7:30971944-30971966 TTTCTCCCATTACCCCCAGGAGG 0: 1
1: 2
2: 39
3: 598
4: 818
1022515382_1022515387 5 Left 1022515382 7:30971916-30971938 CCTCTCCCTGCTTGCTTCTTGTT 0: 1
1: 1
2: 3
3: 65
4: 586
Right 1022515387 7:30971944-30971966 TTTCTCCCATTACCCCCAGGAGG 0: 1
1: 2
2: 39
3: 598
4: 818
1022515378_1022515387 28 Left 1022515378 7:30971893-30971915 CCAGTTGCAGCACACCAGAATCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1022515387 7:30971944-30971966 TTTCTCCCATTACCCCCAGGAGG 0: 1
1: 2
2: 39
3: 598
4: 818

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022515387 Original CRISPR TTTCTCCCATTACCCCCAGG AGG Exonic
900014693 1:139844-139866 TTTCTCCCATCACGCTCAGGTGG - Intergenic
900044560 1:495046-495068 TTTCTCCCATCACGCTCAGGTGG - Intergenic
900044959 1:498453-498475 TTTCTCCCATCACGCTCAGGTGG - Intergenic
900065963 1:729952-729974 TTTCTCCCATCACGCTCAGGTGG - Intergenic
900066362 1:733361-733383 TTTCTCCCATCACGCTCAGGTGG - Intergenic
900066758 1:736767-736789 TTTCTCCCATCACGCTCAGGTGG - Intergenic
900067156 1:740183-740205 TTTCTCCCATCACGCTCAGGTGG - Intergenic
900127374 1:1074518-1074540 TCTCTCCCTATAGCCCCAGGAGG + Intergenic
900468403 1:2837349-2837371 TGTCTCCCCTTACCCACAGACGG - Intergenic
900722888 1:4189234-4189256 TGTCTGCCATCACCCCCAGATGG - Intergenic
900836244 1:5006562-5006584 TGTCTCCCATCACCCCCAGTGGG - Intergenic
900915798 1:5637644-5637666 TGTCTCCCATCAGCCCCAGATGG - Intergenic
901079161 1:6574055-6574077 TGTCTCCCATCACCCCCAGATGG - Intronic
901514522 1:9736039-9736061 TTTCTCCCCTGACCCAAAGGTGG - Exonic
901557751 1:10044998-10045020 TTTCTCCCATCACCCCTAGATGG - Intronic
901868989 1:12126531-12126553 TTTCCTCCAGTACCCCCAGGGGG + Intronic
902066572 1:13693124-13693146 TGTCTCCCATCACCCCTAGATGG - Intergenic
902104212 1:14020029-14020051 TGTCTCCCATCACCCCCAGATGG - Intergenic
902536931 1:17124617-17124639 TGTCTCCCATCACCCCCAGATGG - Intergenic
902570981 1:17346861-17346883 TTTCCCCCATCACCCCCAGCAGG + Intronic
902600099 1:17535140-17535162 TGTCTCCCATCACCCCCAGATGG - Intergenic
902647391 1:17809712-17809734 TGTCTCCCATCACTCCCAGATGG + Intronic
902703563 1:18189589-18189611 TGTCTCCCAGCACCCCCAGTGGG - Intronic
902757205 1:18556862-18556884 TGTCTCCCATCACCCCCAGATGG - Intergenic
902800678 1:18827817-18827839 TGTCTCCCATCACCCCCAGATGG + Intergenic
902803855 1:18848785-18848807 TGTCTCCCATCACCCCCAGATGG + Intronic
903060808 1:20667345-20667367 TGTCTCCCATTACCCCCACATGG + Intronic
903200791 1:21736622-21736644 TTTCTCCCTTTCTCTCCAGGTGG - Exonic
904288069 1:29466261-29466283 TGTCCCCCATCACCCCCAGATGG - Intergenic
904353074 1:29921551-29921573 TGTCTCCCATCACCCCCAGATGG - Intergenic
904435346 1:30491378-30491400 TGTCTCCCATCACCCCCAGATGG - Intergenic
904811538 1:33166152-33166174 TGTCTTCCATCACCCCCAGATGG + Intronic
905030416 1:34879279-34879301 TGTCTCCCGTTACCCTCAGATGG - Intronic
905246917 1:36621390-36621412 TGTCTCCCATCACCCCCAGATGG - Intergenic
905378136 1:37539055-37539077 TGTCACCCATCACCCCCAGATGG + Intronic
905632270 1:39525333-39525355 TCCTTCCCATTATCCCCAGGAGG + Intronic
905665473 1:39760858-39760880 TCCTTCCCATTATCCCCAGGAGG - Intronic
905797947 1:40826016-40826038 TTTCTCCCAGGGACCCCAGGGGG + Intronic
906664718 1:47612354-47612376 TGTCTCCCATCACCCCTAGATGG + Intergenic
906819421 1:48913609-48913631 TGCCTCCCATCACCCCCAGATGG + Intronic
906883058 1:49613660-49613682 TGTCTCCCATCACCCCCAGATGG + Intronic
906999122 1:50832029-50832051 TGTCTCCTATCACCCCCAGATGG + Intronic
907150799 1:52285608-52285630 TGTCTCCCATCACCCCCAGATGG + Intronic
907183383 1:52590228-52590250 TTTCTTCCATGACAGCCAGGAGG + Intergenic
907926079 1:58956366-58956388 TGTCTCCCATCACCCCCAGATGG + Intergenic
908309058 1:62857391-62857413 TGTCTCCCATCATCCCCAGATGG + Intronic
908405957 1:63814592-63814614 TGTCTCCCATCACCCCCAGATGG - Intronic
908476538 1:64494114-64494136 TTTCTCTTCTTACCCCCAGCTGG + Intronic
909087464 1:71184775-71184797 TGTCTCCCATCACCTCCATGTGG + Intergenic
909235391 1:73146835-73146857 TCTCTCCCATCACTCCCAGATGG + Intergenic
909423069 1:75488069-75488091 TGTCTCCCATCACCCCCAGATGG + Intronic
909711190 1:78651300-78651322 TGTCTCCCATCACCCCAAGATGG - Intronic
910209522 1:84778898-84778920 TGTCTCCCAACACCCCCAGAAGG + Intergenic
910469056 1:87531251-87531273 TGTCTCCCATCACCCTCAGAAGG + Intergenic
910485207 1:87705576-87705598 TGTCTCCTATTACCCCCAGATGG + Intergenic
911005149 1:93212945-93212967 TGTCTGCCATGACCCCCAGATGG - Intronic
911147054 1:94562517-94562539 TGTCTCCCGTCACCCCCAGGTGG - Intergenic
911176948 1:94826766-94826788 TTTCTCCCATCCCCAACAGGAGG + Intronic
911365075 1:96928436-96928458 TGTCTCCCATTACCCCCAGATGG + Intergenic
911573004 1:99540382-99540404 TGTCTCCCATCACCCACAGATGG - Intergenic
911737759 1:101356023-101356045 TTTGTGCCATTTTCCCCAGGAGG - Intergenic
912672833 1:111647270-111647292 TGTCTCCCATCACCCCCAGATGG + Intronic
912909749 1:113745769-113745791 TGTCTCCCATCACCCCCAGATGG + Intronic
913094113 1:115500102-115500124 TGTCTCCCATCACTCCCAGATGG - Intergenic
913238240 1:116803725-116803747 TGTCTCCCATCACCCCCAGATGG + Intergenic
913554598 1:119952472-119952494 TGTCTCCCATCACCTCCAGATGG - Intronic
914319884 1:146548936-146548958 TGTCTCCCATCACCCCCAGATGG + Intergenic
914335806 1:146714205-146714227 TGTCTCCCATCACCCCCTGATGG + Intergenic
916086517 1:161274213-161274235 TTTCTTCCAGTTCCCCCAGTTGG + Intronic
916292770 1:163184798-163184820 TTTCCCCCAGAACCTCCAGGAGG + Intronic
916629934 1:166601404-166601426 TGTCTCCCATCACCCCCATATGG - Intergenic
917536186 1:175876362-175876384 TTTATCCTGCTACCCCCAGGAGG + Intergenic
917582542 1:176393429-176393451 TGTCTCTCATTACCCCCAGATGG - Intergenic
917629707 1:176879680-176879702 ATTCTCACATTACCCCAATGGGG + Intronic
917780731 1:178393338-178393360 TGTCTACCATCACCCCCAGATGG - Intronic
918287581 1:183072884-183072906 TGTCTCCCATTGCCCCCAGATGG + Intronic
918476651 1:184932346-184932368 TGTCTCCCATCACCCCCAGATGG - Intronic
918524803 1:185453720-185453742 TGTCTCCCATCACCCCCATATGG + Intergenic
918573332 1:186025054-186025076 TGTTTCCCGTTACCCCCAGATGG - Intronic
918750942 1:188268497-188268519 TGTCTCCCACCACCCCCAGATGG - Intergenic
918889259 1:190243968-190243990 TGTCTCTCATCACCCCCAGATGG + Intronic
920146692 1:203867518-203867540 TGTCTCCCATCACCCCCAGATGG - Intronic
920374189 1:205498304-205498326 TGTCTCCCATCACCCCCAGATGG - Intergenic
920510423 1:206547498-206547520 TGTCTCCCATCACCCCCAGATGG + Intronic
920552859 1:206878696-206878718 TTTCTGCTGTTACCACCAGGTGG - Intergenic
921041842 1:211440215-211440237 TGACTCCCATCACCCCCAGATGG + Intergenic
921402318 1:214738889-214738911 TGTCTCCCATTACCCCCAGATGG - Intergenic
921425283 1:214994319-214994341 TGTCTCCCATCACCCCCAGATGG + Intergenic
922051338 1:221993462-221993484 TGTCTCCCATCACCCCTAGATGG - Intergenic
922093688 1:222422689-222422711 TATCTCCCATCACCCCCAGATGG + Intergenic
922101088 1:222477301-222477323 TTTCTCCCATCACGCTCAGGTGG - Intergenic
922111847 1:222566522-222566544 TGTCTCCCATCACCCCCAGATGG - Intronic
922164703 1:223105594-223105616 TGTCTTCCATCACCCCCAGATGG - Intergenic
922236943 1:223729066-223729088 ATTCCCCCATTACTCCAAGGCGG + Intronic
922262189 1:223952439-223952461 TTCCTCCCATCACGCTCAGGTGG - Intergenic
922329377 1:224560668-224560690 TGTCTCCCATCACCCCCAGATGG + Intronic
922501664 1:226101416-226101438 TGTCTCCCATCACCCCCAGATGG + Intergenic
922733531 1:227967371-227967393 TTTCTCCCATCACGCTCAGGTGG + Intergenic
923092554 1:230751218-230751240 CTGCTCCCCTGACCCCCAGGAGG + Intronic
923230236 1:231979149-231979171 TGTCTCCCATCACCCCCAGATGG + Intronic
923377350 1:233377829-233377851 TGTCTCCCATCACTCCCAGATGG - Intronic
923512537 1:234664823-234664845 TGTCTCCCGTCACCCCCAGATGG + Intergenic
923534668 1:234839983-234840005 TGTCTCCCATCACCCCCAGATGG + Intergenic
924076114 1:240338904-240338926 TGTCTCCCATCACCCCCAGATGG - Intronic
924244497 1:242070575-242070597 TGTCTCCCATTACCCCCTGATGG - Intergenic
924344013 1:243057418-243057440 TTTCTCCCATCACGCTCAGGTGG - Intergenic
924821766 1:247498904-247498926 TGTCTCCCATCACCCTCTGGTGG - Intergenic
1062978739 10:1704356-1704378 TGTCTCCCATCATCCCCAGGTGG - Intronic
1063499437 10:6539507-6539529 TGTCTCCCATTACCCCCAGATGG + Intronic
1063506137 10:6601414-6601436 TGTCTCCCATCACCCCCAGATGG - Intergenic
1063554586 10:7066139-7066161 TGTCTCCCATCACCCCCAGATGG - Intergenic
1063588897 10:7377559-7377581 TGTCTCCCATCACCCCCAGATGG - Intronic
1063604688 10:7512386-7512408 TGTCTCCCATCACCCCCAGATGG - Intergenic
1063623644 10:7669720-7669742 TTTCTCATTTTACCTCCAGGAGG + Intergenic
1063765999 10:9141241-9141263 TGTCTCCCATCACCCCCAGACGG - Intergenic
1064089002 10:12367590-12367612 TGTCTCCCATCACCCCCAGGTGG - Intronic
1064104331 10:12488690-12488712 TGTCTCCCATCACCTCCAGATGG - Intronic
1064112535 10:12551338-12551360 TGTGTCCCATCACCCCCAGATGG + Intronic
1064119896 10:12609503-12609525 TGTCTCCCATCATCCCCAGATGG - Intronic
1064204414 10:13311162-13311184 TGTCTCCCATCACCCCCAGATGG + Intergenic
1064267325 10:13835666-13835688 TGTCTCCCATCACCCCCAGATGG + Intronic
1064280182 10:13944370-13944392 TGTCTCCCATCACCCTCAGGTGG + Intronic
1064368174 10:14726986-14727008 TGTCTCCCATCACCCCCAAATGG - Intronic
1064562936 10:16610596-16610618 TATTTCCCATCACCCCCAGATGG + Intronic
1064621414 10:17221524-17221546 TGTCTCCCATCATCCCCAGATGG + Intergenic
1064688602 10:17891037-17891059 TGTCTCCCATTACCCCCAGATGG + Intronic
1064694615 10:17952926-17952948 TTTCTCCATTTACCAACAGGTGG - Intronic
1064699944 10:18008366-18008388 TATCTCCCATCACCTCCAGATGG + Intronic
1064781243 10:18841162-18841184 TGTCTCCCATCATCCCCAGATGG - Intergenic
1064901867 10:20303841-20303863 TGTCTCCCATCACTCCCAGATGG + Intergenic
1064922887 10:20537543-20537565 CATCTCCCATCACCCCCAGGTGG - Intergenic
1065138064 10:22692151-22692173 TGTCTCCCATCACCCCCAGATGG - Intronic
1065505827 10:26429296-26429318 TGTCTCTCATCACCCCCAGATGG + Intergenic
1065939691 10:30553051-30553073 TGTCTCCCATCACCCCCAGATGG - Intergenic
1065947833 10:30623656-30623678 TGTCTCCCATCACCCCCAGATGG + Intronic
1066147705 10:32578492-32578514 TGTCTCCCATCACCCCCAGATGG - Intronic
1066171686 10:32855467-32855489 TGTCTCCCATCACCCCCAGATGG - Intronic
1066209770 10:33225236-33225258 TTTCTCACTTCACACCCAGGGGG + Intronic
1066280570 10:33913739-33913761 TGTCTTCCATCACCCCCAGATGG - Intergenic
1066541581 10:36452409-36452431 TGTCTCCCATCACCTCCAGATGG + Intergenic
1066542549 10:36463774-36463796 TATCTCCCATCACCCCCAGATGG + Intergenic
1066612366 10:37263500-37263522 TGTCTCCCATCACCCCTAGATGG - Intronic
1066732319 10:38447645-38447667 TTTCTCCCATCACGCTCAGGTGG + Intergenic
1067139250 10:43642678-43642700 TGTCTCCCATCACCCCTAGATGG + Intergenic
1067736887 10:48862519-48862541 TGTCTCCCATCACCCTCAGATGG + Intronic
1067801412 10:49361811-49361833 ATACCCCCATTACCCCCACGGGG - Intergenic
1068024807 10:51629451-51629473 TGTCTCCCATCACCCCCAGATGG - Intronic
1068544272 10:58328274-58328296 TGTCTCCCATCACCCCCAGATGG - Intergenic
1068585411 10:58792668-58792690 TGTCTCCCATCACCTCCAGATGG + Intronic
1069049617 10:63778765-63778787 TGTCTCTCATCACCCCCAGATGG + Intergenic
1069098297 10:64287033-64287055 TTTCTCCCCTTGCCCAGAGGCGG + Intergenic
1069358446 10:67614453-67614475 TGTCTCCCATCACCCCCAGATGG - Intronic
1069372264 10:67760825-67760847 TGCCTCCCATCACCCCCAGATGG + Intergenic
1069882465 10:71602337-71602359 GTTCTCCCAGCAGCCCCAGGAGG + Intronic
1070222454 10:74463372-74463394 TGACTCCCATCACCCCCAGATGG - Intronic
1071414897 10:85432276-85432298 TTTCTCCCATTCACCTCTGGTGG + Intergenic
1071671054 10:87609887-87609909 TATCTCCCATCACCTCCAGAAGG + Intergenic
1071829389 10:89356610-89356632 TGTCTCCCATCACCCCCAGATGG + Intronic
1071866593 10:89741122-89741144 TGTCTCCCATCACCCCCAGATGG - Intronic
1071909152 10:90211266-90211288 TGTGTCCCATCACCCCCAGATGG - Intergenic
1071982015 10:91012968-91012990 TGTCTTCCATCACCCCCAGATGG - Intergenic
1072411153 10:95203241-95203263 TGTCTCCCATCACTCCCAGATGG + Intronic
1072672309 10:97439529-97439551 TGTCTCCCATCACCCCCAGATGG + Intronic
1072858989 10:98983294-98983316 TGTCTCCCATCATCCCCAGATGG - Intronic
1073659958 10:105463928-105463950 TCTTTCCCATCACCCCCAGATGG + Intergenic
1073699223 10:105906876-105906898 TGTCTCCCATCACCCCCCAGTGG + Intergenic
1073715884 10:106106940-106106962 TGTCTCCCTTCACCCCCAGATGG + Intergenic
1073740296 10:106398915-106398937 TGTCTCCCATCACCCCCAAATGG + Intergenic
1073746892 10:106479409-106479431 TGTTTCCCATTACCCCCAGATGG + Intergenic
1074283236 10:112073140-112073162 TGTCTCCCATCAGCCCCAGATGG + Intergenic
1074294362 10:112169974-112169996 TGTCTCCTATCACCCCCAGTTGG + Intronic
1074610233 10:115014741-115014763 TATCTCCCATTGCCCCCAGATGG - Intergenic
1074621096 10:115123926-115123948 TGTCTCCCATCAGCCCCAGATGG + Intronic
1074729061 10:116349145-116349167 TGTCTCCCGTCACCCCCAGATGG + Intronic
1074744023 10:116513474-116513496 TGTCTCCCATCATCCCCAGATGG - Intergenic
1074821935 10:117186172-117186194 TATCTCCCATCACCCCCAGATGG + Intergenic
1074968604 10:118516436-118516458 TGTCTCCCATCACCCCCAGATGG - Intergenic
1075237349 10:120742742-120742764 TGTCTCCCATCACCCCCAGATGG + Intergenic
1075630713 10:123999201-123999223 TGTCTCCCATCACCCCCAGATGG - Intergenic
1075682859 10:124344740-124344762 TGTCTCCCATCACCCCCAGATGG - Intergenic
1075853156 10:125604856-125604878 TGTCTCCTATTACCCCCAGAAGG + Intronic
1075880618 10:125847759-125847781 TGTCTCCCATCACCCCCAGATGG - Intronic
1075927837 10:126267470-126267492 TGTCTCCCATCACCCCCAGATGG - Intronic
1075993451 10:126857589-126857611 TGCCTCCCATCACCCCCAGATGG + Intergenic
1076135541 10:128043294-128043316 TGTCTCCCATCACCCCCAGAGGG - Intronic
1076201335 10:128561027-128561049 TGTCTCCCATCATCCCCAGATGG - Intergenic
1076284918 10:129285486-129285508 TGACTCTCATCACCCCCAGGTGG - Intergenic
1076450465 10:130553783-130553805 TGTCTCCCATCACCCCCAGGTGG - Intergenic
1076915508 10:133421477-133421499 CTTCTGACATTTCCCCCAGGAGG - Exonic
1076970890 11:131521-131543 TTTCTCCCATCACGCTCAGGTGG - Intergenic
1076971287 11:134944-134966 TTTCTCCCATCACGCTCAGGTGG - Intergenic
1077426496 11:2481770-2481792 TGTCTCCCATCACCCCCAGATGG + Intronic
1077922538 11:6652515-6652537 TTTCTCCCATTCCTCCTGGGAGG - Intronic
1077963172 11:7097100-7097122 TGTCTCCCATCACCTCCAGTTGG + Intergenic
1078592297 11:12653723-12653745 TATCTCCCATCACCCCAAGATGG - Intergenic
1078643294 11:13115663-13115685 TTGCTCCCTTTCCCCTCAGGAGG + Intergenic
1078826104 11:14931625-14931647 TGTCTCCCATGACCCCCAGAAGG - Intronic
1079000622 11:16752097-16752119 TGTCTCCCATCACCCCTAGATGG + Intronic
1079162556 11:18008570-18008592 TTTACCCCATTACCTCCAGAGGG - Intronic
1079405768 11:20144358-20144380 TACCTCCCATCACCCCCAGATGG - Intergenic
1079570127 11:21932739-21932761 TGTCTCCCATCACCCCCATTTGG + Intergenic
1080066417 11:28020324-28020346 TGTCTCCTATTACCCCAAGATGG + Intergenic
1080244502 11:30164219-30164241 TGTCTCCCATTACCCCCACATGG - Intergenic
1080492575 11:32782122-32782144 TGTCTCCCATCACCCCCAGATGG + Intronic
1080505721 11:32911278-32911300 CTTCCCCCACCACCCCCAGGAGG - Intronic
1080722761 11:34866086-34866108 TGTCTCCCATCACCCCCAGATGG + Intronic
1080854249 11:36098109-36098131 TCTCTCCAAAGACCCCCAGGAGG + Intronic
1080903149 11:36514614-36514636 TGTCTCTCATCACCCCCAGATGG - Intronic
1081262414 11:40977020-40977042 TGTCTCCCATCAGCCCCAGATGG - Intronic
1081263622 11:40991645-40991667 TGTCTCCCATCACCCCCAGATGG - Intronic
1081294202 11:41365290-41365312 TGTCTCCCAACACCCCCAGATGG + Intronic
1081475072 11:43421672-43421694 TGTCTCCCATCACACCCAGATGG + Intronic
1081480613 11:43484981-43485003 TGTCTCCCATCACTCCCAGATGG + Intronic
1081791206 11:45787373-45787395 TGTCTCCTATCACTCCCAGGTGG - Intergenic
1082263787 11:50098128-50098150 TGTTTCCCATCACCCCCAGATGG - Intergenic
1082769907 11:57199825-57199847 TGTCTCCCATCACCCCCAGGTGG + Intergenic
1083414359 11:62515750-62515772 TTTCTCCCACTACCTCCCGAAGG + Intronic
1084768814 11:71329502-71329524 TGTCTCCCATCACCCCCAGATGG - Intergenic
1084780508 11:71405160-71405182 CGTCTCCCATCACCCCCATGTGG - Intergenic
1084932374 11:72567289-72567311 TGTCTCCCATCACCCCTAGATGG - Intergenic
1085103631 11:73822994-73823016 TGTCTCCCATCACCCCCAGATGG + Intronic
1085598569 11:77833335-77833357 TGTCTCCCATCACTCCCAGATGG - Intronic
1086345725 11:85893797-85893819 TGTCTCCCATCACCCCCAGATGG + Intronic
1086848403 11:91780057-91780079 TGTCTCCCATCACCCCAAGAAGG - Intergenic
1087177868 11:95111523-95111545 TGTCTCCCATCACCCCCAGATGG - Intronic
1087296187 11:96377001-96377023 TTTCTCCCACAACCCCCAGGAGG + Intronic
1087714086 11:101586898-101586920 TGTCTCCCATCACCCCCAGATGG - Intronic
1087926126 11:103920723-103920745 ATTCACCCAGTATCCCCAGGTGG + Intronic
1088021235 11:105122137-105122159 TTTCTCCCCTTAACCTCAGCAGG - Intergenic
1088110955 11:106260738-106260760 TGTCTCCCATCACCCCCAGATGG - Intergenic
1088482090 11:110303943-110303965 TGTCTCCCATCACCCCGAGATGG + Intergenic
1088497899 11:110450287-110450309 TGTCTCCCATCACCTCCAGATGG - Intronic
1088736271 11:112730204-112730226 TGTCTCCCATTACCCCTAGATGG + Intergenic
1089151135 11:116365280-116365302 TGTCTCCCATCACCCCCAGATGG + Intergenic
1089979372 11:122759599-122759621 TGTCTCCCATCACCCACAGATGG - Intronic
1090325833 11:125885917-125885939 TGTCTCCCATCACCCCCAGATGG + Intronic
1090485389 11:127108010-127108032 TGTGTCCCATCACCCCCAGATGG + Intergenic
1090659031 11:128868790-128868812 TGTCTCCCATCACCCCCAGATGG - Intergenic
1090671243 11:128947085-128947107 TGTCTCCCATCACCCCCAGATGG - Intergenic
1090704852 11:129326849-129326871 TGTCTCCCATCATCCCCAGATGG - Intergenic
1090975897 11:131679621-131679643 TTTCTCCCATTTCCCTCTGATGG + Intronic
1091032927 11:132207382-132207404 TATCTCCCATCACCCCCAGATGG + Intronic
1091240435 11:134048336-134048358 TTCCCCCCACTACCCCAAGGTGG - Intergenic
1091335489 11:134762792-134762814 TTTCTCCCTGCAGCCCCAGGCGG - Intergenic
1091479711 12:814907-814929 TGTCTCCCATCACCCCCAGATGG - Intronic
1091683122 12:2540958-2540980 TTTCCCTCATGACCCTCAGGAGG - Intronic
1091942587 12:4501643-4501665 TGTCTCCCATCACCCCTAGATGG + Intronic
1092067961 12:5607802-5607824 TGTCTCCCGTCACCCCCAGATGG + Intronic
1092194939 12:6543547-6543569 TATCTCCCATCACCCCCAGATGG + Intronic
1092307766 12:7319128-7319150 TATCTCCCATCACCCCCAGATGG - Intronic
1092619815 12:10251699-10251721 TGTCTCCCGTCACCCCCAGATGG - Intergenic
1092741646 12:11636226-11636248 TGTCTCCCATCACCTCCAGATGG + Intergenic
1092766071 12:11854109-11854131 TGTCTCCCATCACCCCCAGATGG - Intronic
1092820260 12:12347239-12347261 TGTCTCCCATCACCCCCAGATGG - Intronic
1092871664 12:12811076-12811098 TGTCTCCCATTACCCCCACATGG + Intronic
1092938916 12:13389556-13389578 CGTCTCCCATCACCCCCAGATGG + Intergenic
1093104431 12:15068922-15068944 TGTCTCCCATCACCCCCAGATGG + Intergenic
1093168170 12:15829259-15829281 TGTCTCCCATCACCCCCAAATGG - Intronic
1093187558 12:16038598-16038620 TTCCTCCCATTAAACCCAGCTGG + Intergenic
1093245920 12:16736499-16736521 TGTCTCCCATCACCCCCAGATGG + Intergenic
1093509722 12:19912134-19912156 TATCTCCCATTACCTCCATATGG + Intergenic
1093793126 12:23278362-23278384 TGTCTCACATCACCCCCAGATGG - Intergenic
1093810813 12:23490394-23490416 TGTCTCCCATCACCCCCAGATGG + Intergenic
1093886658 12:24469107-24469129 TATCTCCCATCACACCCAGATGG - Intergenic
1094043635 12:26143954-26143976 TGTCTCCCATCACCCCCACATGG + Intronic
1094053904 12:26249264-26249286 TCTCTCCCATCACCCCCAGGTGG - Intronic
1094066210 12:26363273-26363295 TGTCTCCCATCACCCCCAGATGG + Intronic
1094584845 12:31768386-31768408 TGTCTCCCATCACCCCCATATGG + Intergenic
1094673443 12:32594378-32594400 TGTCTCCCATCACTCCCAGATGG + Intronic
1095381624 12:41601278-41601300 TGTCTCCCATCACTCCCAGATGG - Intergenic
1095764318 12:45877422-45877444 CTTCTCCCATCACCCCCAGATGG + Intronic
1096061500 12:48704473-48704495 TGTCTCCCATCACCCCCAGATGG + Intronic
1096431280 12:51545283-51545305 TGTATCCCATCACCCCCAGACGG - Intergenic
1096728296 12:53583382-53583404 TATCTCCCATCACCCCCAGATGG + Intronic
1097354650 12:58587520-58587542 TGTCTCCCATCACCCTCAGATGG + Intronic
1097626004 12:62001467-62001489 TGTCTCCCATCACCCCAAGATGG - Intronic
1097817316 12:64089304-64089326 CTTCTCCCATTCCCTCCAGTGGG + Intronic
1097872578 12:64613372-64613394 TTTCTCACTTTTCCACCAGGTGG - Intronic
1097897253 12:64837423-64837445 TTTCTCCCATCACCCCCAGTTGG - Intronic
1097924875 12:65116448-65116470 TGTCTCCCATCACCCTCAGATGG + Intronic
1098199958 12:68043978-68044000 TGTCTCCCATCACCCCCAGATGG + Intergenic
1099154549 12:79158236-79158258 TGTCTCCCATCACCCCCAGATGG - Intronic
1099446643 12:82760853-82760875 TGTCTCCCCTCACCCCCAGATGG + Intronic
1099748011 12:86732489-86732511 TGTCTTCCATCACCCCCAGATGG - Intronic
1100230848 12:92605514-92605536 TGACTCCCATTACCCCCACATGG + Intergenic
1100424365 12:94469562-94469584 TGTCTTCCATCACCCCCAGATGG - Intergenic
1100660860 12:96697332-96697354 TTTTTCTCATTACCCCTAGGAGG - Intronic
1100724623 12:97395689-97395711 TGTCTCCCATCACCCCCAGATGG - Intergenic
1100899657 12:99223465-99223487 TGTCTCCCATTACCCCCAGATGG - Intronic
1101734969 12:107456499-107456521 TGTCTCCCATCACCCCCAGATGG + Intronic
1101955922 12:109212472-109212494 TGTCTCCCATCACCCCCAGATGG - Intronic
1102099445 12:110267091-110267113 TTTCTCCCATTATCGTCAGCAGG + Intergenic
1102391063 12:112549038-112549060 TGTCTCCCATCACTCCCAGATGG - Intergenic
1102601766 12:114036873-114036895 TGTCTCCCATCACCCACAGATGG + Intergenic
1102988535 12:117298175-117298197 TGTCTCCCATCTCCCCCAGATGG - Intronic
1103269227 12:119658344-119658366 TGTCTCCCATCACCCCTAGATGG + Intergenic
1104176035 12:126333581-126333603 TGTCTCCCATCACCCCCATATGG + Intergenic
1104246836 12:127051243-127051265 TGTCTCCCATCACCCCCAGATGG + Intergenic
1104418491 12:128615479-128615501 TGTCTCCCATCACTCCCAGAAGG - Intronic
1104538502 12:129640960-129640982 TGTCTCCCATCACCCTCAGATGG + Intronic
1104577564 12:129981711-129981733 TGTCTCCCATCACCCCTAGATGG - Intergenic
1104708727 12:130969553-130969575 TGTCTCCCATCACCCCCAGAGGG + Intronic
1105634235 13:22201939-22201961 TTTCTGACATTACCCCCTGAAGG - Intergenic
1105912906 13:24887557-24887579 TGTCTCCCATCACCCCCAGATGG + Intronic
1105970738 13:25427304-25427326 TGTCTCCCATCACCCCCAGATGG + Intronic
1106939853 13:34766194-34766216 TGTCTCCCATCACCCTCAGATGG + Intergenic
1106985542 13:35343772-35343794 TATCTCCCATCACCCCCAGATGG + Intronic
1107593621 13:41937369-41937391 TGTCTCCCATCACCCCCAGATGG - Intronic
1107609653 13:42100276-42100298 TGTCTCCCATCAGCCCCAGATGG + Intronic
1108345891 13:49546615-49546637 TGTCTCCCATCACCCCCAGATGG - Intronic
1108427562 13:50319192-50319214 TGTCTCCTATCACCCCCAGGTGG + Intronic
1108515203 13:51194961-51194983 TGTCTCCCATCACCCCCAGACGG - Intergenic
1108588875 13:51894907-51894929 TGTCTCCCATGACCCCCAGATGG - Intergenic
1109078533 13:57867955-57867977 TGTCTCCCATTGTCCCCAGACGG - Intergenic
1109410695 13:61963966-61963988 TGTCTCCCATCACCCCCAGATGG - Intergenic
1109622588 13:64928697-64928719 TGTCTCCCATCACCCCCAGATGG - Intergenic
1110419054 13:75284375-75284397 TGTCTCCCATCATCCCCAGATGG - Intergenic
1110730046 13:78869578-78869600 TGCCGCCCATTAACCCCAGGAGG - Intergenic
1110745098 13:79043259-79043281 TGTCTCCCATTGCCCACAGATGG - Intergenic
1110754221 13:79152570-79152592 TGTCTCCCATCACCCCTATGTGG + Intergenic
1110778808 13:79440943-79440965 TGTCCCCCATCACCCCCAGATGG - Intergenic
1110849990 13:80233880-80233902 TGTCTCTCATCACCCCCAGATGG - Intergenic
1111046399 13:82819597-82819619 TGTCTCCCATCATCCCCAGATGG + Intergenic
1111200186 13:84926812-84926834 TGTCTCCCATCAACCCCAGATGG - Intergenic
1111359369 13:87154764-87154786 TTTTTCCCATCACCCCTAGTTGG - Intergenic
1111654257 13:91132364-91132386 TGTCTTCCATCACCCCCAGATGG - Intergenic
1111668565 13:91300272-91300294 TGTCTCCCATCACCCCCAGATGG + Intergenic
1111694107 13:91601699-91601721 TGTCTCCCATCACCCCCAGATGG + Intronic
1111731134 13:92078429-92078451 ATTCTCACATTAACCCCAGGAGG - Intronic
1111989793 13:95105100-95105122 TGTCTCCCATCACCCCCAGATGG - Intronic
1112032967 13:95474166-95474188 TGTCTCCCATCACCCCCAGATGG - Intronic
1112222664 13:97506867-97506889 TGCCTCCCATCACCCCCAGATGG + Intergenic
1113126297 13:106983046-106983068 TGTCTCCCATCACCCCCAGATGG + Intergenic
1113369457 13:109709582-109709604 TGTCTCCCATCATCCCCAGATGG + Intergenic
1113401444 13:109997748-109997770 CGTCTCCCATCACCCCCAGATGG + Intergenic
1113658373 13:112085748-112085770 TGTCTCCCATCACCCCCAGATGG - Intergenic
1114058405 14:18996654-18996676 CATCTCCCATCACCCCCAGATGG + Intronic
1114104141 14:19405100-19405122 CATCTCCCATCACCCCCAGATGG - Intronic
1114160666 14:20162871-20162893 TTTCTCCCATTTCTCCCATTTGG - Intergenic
1114598116 14:23931587-23931609 TGTCTCCCATCACCCCGATGGGG + Intergenic
1114982062 14:28177562-28177584 TGTCTCCCATCACCCCCAGATGG + Intergenic
1115334481 14:32231233-32231255 TTTCTTCCATTCCCCAGAGGAGG - Intergenic
1116419190 14:44713407-44713429 TGCCTCCCATCACCCCCAGATGG - Intergenic
1116423733 14:44764604-44764626 TGTCTCCCATCACCCTCAGATGG + Intergenic
1116522448 14:45866724-45866746 TGTCTCCCATCACCCTCAGATGG - Intergenic
1116823906 14:49652677-49652699 TGTCTCCCATCATCCCCAGATGG + Intronic
1116933931 14:50717825-50717847 TGTCTCCCATAACCCCCAGATGG - Intergenic
1117493400 14:56275492-56275514 TGTCTCCCATCATCCCCAGATGG - Intronic
1117558085 14:56907134-56907156 TGTCTCCCATCACCCCCAGATGG - Intergenic
1117574997 14:57088760-57088782 TGTCTCCCATCATCCCCAGATGG + Intergenic
1117630937 14:57690705-57690727 TGTCTCCCATTACCCCCAGATGG - Intronic
1117851514 14:59976121-59976143 TGTCTCCCAACACCCCCAGATGG + Intronic
1118359259 14:65042356-65042378 TGTCTCCCATCACCCCCAAATGG - Intronic
1118526626 14:66651822-66651844 TATCTCCCATCACCCCGAGATGG + Intronic
1118535901 14:66763974-66763996 TGTCTCCCATCACCCCCAGATGG + Intronic
1119062108 14:71485551-71485573 TGTCTCCCATCACCCCCAGATGG + Intronic
1119127239 14:72138818-72138840 TGTCTCCCATCACCCCCAGATGG + Intronic
1119194239 14:72705318-72705340 TGTCTCCCATCACCCCCAGATGG + Intronic
1119454450 14:74742684-74742706 TGTCTCCCATCAACCCCAGATGG - Intergenic
1119626209 14:76178582-76178604 TGTTTCCCATCACCCCCAGGTGG - Intronic
1120141281 14:80932618-80932640 TGTCTCCCATGACCCCAAGACGG + Intronic
1120149831 14:81020982-81021004 TGTCTCCCATCACCCACAGATGG + Intronic
1120236373 14:81896248-81896270 TGTCTCTCATCACCCCCAGATGG - Intergenic
1120347377 14:83308121-83308143 TGTCTCTCATTCCCCCCAGATGG - Intergenic
1120464762 14:84842397-84842419 TGTCTCCCATCACCCCCAAATGG - Intergenic
1120635702 14:86948327-86948349 TGTCTCCCATCACCCCCAGATGG - Intergenic
1120685677 14:87533890-87533912 TGTCTCCCATCACCCCCAGATGG + Intergenic
1120810952 14:88802971-88802993 TGTCTCCCATCAACCCCAGATGG + Intergenic
1121078148 14:91086146-91086168 TTTCTCCCATCACCCCCAGATGG + Intronic
1121131765 14:91453784-91453806 TGTCTCCCATCACCCCCAGATGG - Intergenic
1121270854 14:92637236-92637258 TGTCTCCCATCACCCCCAGATGG - Intronic
1121290582 14:92771697-92771719 TGTCTCCCATCACCCCCAGATGG + Intergenic
1121539773 14:94716629-94716651 TGTCTCCCATCACCCCCAGATGG + Intergenic
1122086418 14:99309812-99309834 TATCTCCCATCACTCCCAGATGG - Intergenic
1122112349 14:99511217-99511239 TCTCTCCCATGACACCCAGAAGG + Exonic
1122151338 14:99727673-99727695 CTTCTCCCATCACCACCACGAGG - Intergenic
1122305483 14:100763440-100763462 TGTCTCCCATCACCCCCAGATGG - Intergenic
1122833718 14:104420865-104420887 TGTCTCCCATCACCCCCAGATGG + Intergenic
1123669835 15:22645051-22645073 ATGCTCACATTAACCCCAGGAGG - Intergenic
1123670251 15:22649477-22649499 TGTCTCCCATTGCCCCCAGCTGG - Intergenic
1124137990 15:27051853-27051875 CGTCTCCCATCACCCCCAGATGG - Intronic
1124162763 15:27288414-27288436 TGTCTCCCATCACCTCCAGATGG - Intronic
1124450101 15:29780293-29780315 TGTCTCCCATCACCCCCAGATGG - Intronic
1124525808 15:30451466-30451488 ATGCTCACATTAACCCCAGGAGG - Intergenic
1124526223 15:30455895-30455917 TGTCTCCCATTGCCCCCAGGTGG - Intergenic
1124772430 15:32551789-32551811 TGTCTCCCATTGCCCCCAGGTGG + Intergenic
1124772847 15:32556219-32556241 ATGCTCACATTAACCCCAGGAGG + Intergenic
1124808188 15:32907301-32907323 TGTCTCCCATCACCCCCAGATGG - Intronic
1125135204 15:36333240-36333262 TGTCTCCCATCACCCCAAGATGG + Intergenic
1125374418 15:39013459-39013481 TCTCTCCCACTGCCGCCAGGTGG - Intergenic
1125442871 15:39722234-39722256 TGTCTCCCATTACCCCCGGATGG + Intronic
1125750175 15:42022524-42022546 TCTCTCCCATAACCCCCAGATGG - Intronic
1125752557 15:42038433-42038455 TGTCTCCCATCACCCCCAAATGG - Intronic
1125860749 15:42997253-42997275 TGTCTCCCATGACCCCCAGATGG + Intronic
1125979546 15:43987951-43987973 TGTCTCCCATGACCCCCAGATGG - Intronic
1125993333 15:44132041-44132063 TGTCTCCCATTACCCCCAGATGG - Intronic
1126118207 15:45228046-45228068 TGTCTCCCATCACCCCTAGATGG + Intergenic
1126425397 15:48522137-48522159 TGTCTCCCATCACCCTCAGATGG + Intronic
1126474926 15:49055271-49055293 TGTCTCCCATCATCCCCAGATGG - Intergenic
1126704191 15:51392413-51392435 TGTCTCCCATCACCCCCAGATGG + Intronic
1127063566 15:55213744-55213766 TGTCTCCTATCACCCCCAGATGG + Intronic
1127254914 15:57281721-57281743 TCTGTCCCATCACCCCCAGATGG + Intronic
1127441858 15:59016978-59017000 TGTCTCCCATCACCCCCAGTTGG + Intronic
1127618382 15:60709665-60709687 TGTCTCCCATCACCCCCATATGG + Intronic
1127809471 15:62551018-62551040 TGTCTCCCATCAACCCCAGATGG - Intronic
1127863393 15:63012800-63012822 TGTCTCCCATCACCCCCAGATGG + Intergenic
1128061920 15:64740787-64740809 TTTCTCCAATGCCTCCCAGGAGG - Exonic
1128110543 15:65073362-65073384 TGTCTCCCATCACCTCCAGATGG - Intronic
1128118857 15:65131279-65131301 TGTCTCCTATCACCCCCAGATGG + Intronic
1128176010 15:65556288-65556310 TGTCTCCCATCACCCCCAGATGG - Intronic
1128215584 15:65932200-65932222 TCCCTCCCTTTACCCCCATGTGG - Intronic
1128342231 15:66830573-66830595 TTGCTCTCATGACACCCAGGAGG + Intergenic
1128589055 15:68878361-68878383 TTTCTCCCTTTGCCCTCAGCAGG - Intronic
1129279218 15:74470694-74470716 TGTCTCTCATCACCCCCAGACGG - Intergenic
1129344585 15:74908638-74908660 TGTCTCCCATCACACCCAGATGG - Intergenic
1129703137 15:77779501-77779523 TGTCTCCCATCATCCCCAGATGG - Intronic
1129886067 15:79037866-79037888 TGTCTCCCATTACCCCCAGATGG - Intronic
1130630142 15:85559578-85559600 TGTCTCCCATCACCCCCTGATGG - Intronic
1130791668 15:87161777-87161799 GTTCTGCCATTACACCAAGGAGG + Intergenic
1131030127 15:89179498-89179520 TGTCTCCCATCACCCCCAGATGG + Intronic
1131301353 15:91202471-91202493 TTTTTCCCAAGACACCCAGGTGG - Intronic
1131499924 15:92952465-92952487 TGTCTCCCATCACCCCCAGATGG - Intronic
1131804633 15:96108744-96108766 TGTCTCCCATCACCCCCAGATGG + Intergenic
1131893009 15:96994235-96994257 TGTCTCCCATCATCCCCAGATGG - Intergenic
1132032099 15:98446666-98446688 TGTCTCCCATCACCCCCAGATGG + Intronic
1132033330 15:98457293-98457315 TGTCTCCCATCACCCCCAGATGG - Intronic
1132164706 15:99574509-99574531 TGTCTCCCATCACCCCAAGATGG - Intronic
1132344080 15:101097159-101097181 TGTCTCCCATCACCCCCAGAAGG - Intergenic
1132379019 15:101353188-101353210 TGTCTCCCATCACCCCCAGACGG - Intronic
1132385503 15:101397498-101397520 ATTCTCCCATCCCCCACAGGAGG + Intronic
1132643986 16:990501-990523 TTTCCCCCATGACCACGAGGCGG + Intergenic
1132774851 16:1587698-1587720 GGGCTCCCCTTACCCCCAGGTGG - Intronic
1132852138 16:2029563-2029585 TATCGCCCATTCGCCCCAGGTGG + Exonic
1133214217 16:4281465-4281487 TATCTCCCATCACCCCCAGATGG - Intergenic
1133441364 16:5823764-5823786 TGTCTCCCATCACCCCCAGATGG + Intergenic
1133465021 16:6020163-6020185 TGTCCCCCCCTACCCCCAGGAGG + Intronic
1133515542 16:6505419-6505441 ATGCTCCCATTACATCCAGGAGG + Intronic
1133650362 16:7807002-7807024 TGTCTCCCATCACCCCCAGATGG + Intergenic
1133930016 16:10224415-10224437 TTCCTCCCACAACCCACAGGTGG + Intergenic
1133967986 16:10545601-10545623 TGTCTCCCATCACCCCCAGATGG + Intronic
1134214824 16:12308951-12308973 TTTGTCCCATTAGCCCCAGCTGG - Intronic
1134379060 16:13707592-13707614 TCTCTCCCATCACCCCCAGAAGG + Intergenic
1134472479 16:14538965-14538987 TGTCTCCCATCACCCCCAGATGG + Intronic
1134639591 16:15819582-15819604 TGTCTCCCATCACCCCCAGATGG + Intronic
1134647399 16:15880903-15880925 TGCCTCCCATCACCCCCAGATGG + Intronic
1134665570 16:16016046-16016068 TTTCTGCCATTACATCCCGGGGG + Intronic
1135144505 16:19949735-19949757 TGTCTCCCATTACTCTCAGATGG - Intergenic
1135232302 16:20720310-20720332 TATCTCCCATTACTCCCAGATGG - Intronic
1135284583 16:21182418-21182440 TGTCTCCCGTCACCCCCAGTTGG + Intergenic
1135348356 16:21708204-21708226 TGTCTCTCATCACCCCCAGATGG - Intronic
1135904321 16:26497136-26497158 TTTCTCCCATCACCACCAGATGG + Intergenic
1136241745 16:28948885-28948907 TGTCTCCCATTTCCCCTAGGAGG - Intergenic
1137240047 16:46648425-46648447 ATTCTCTCATCACCCCCAGATGG + Intergenic
1137295094 16:47084789-47084811 TGTCTCTCATCACCCCCAGATGG + Intronic
1137306253 16:47203514-47203536 TGTCTCCCATCACCCCCAGATGG - Intronic
1137945343 16:52728691-52728713 TATCTCCCATTGCCCCCAGATGG - Intergenic
1138100972 16:54252263-54252285 TGTCTCCCATCACACCCAGATGG + Intronic
1138109538 16:54312529-54312551 TGTCTCCTATCACCCCCAGATGG - Intergenic
1138203673 16:55108491-55108513 TGTCTCCCATCACCCCCAGATGG - Intergenic
1138313717 16:56050345-56050367 TGTCTCCTATCACCCCCAGGTGG + Intergenic
1138334603 16:56243096-56243118 TGTCTCCCATCACCCCTAGACGG + Intronic
1138508167 16:57489294-57489316 TGTCTCCCATCACCCCCAGATGG - Intergenic
1138694221 16:58796678-58796700 TGTCTCCCATCACCCCCAGATGG + Intergenic
1138708496 16:58942246-58942268 TGTCGCCCATCACCCCCAGATGG + Intergenic
1138914553 16:61447548-61447570 TGTCTCCCATCCCCCCCAGATGG - Intergenic
1139120419 16:64009551-64009573 TGTCTCCCATCACCCCAAGATGG - Intergenic
1139997819 16:70997022-70997044 TGTCTCCCATCACCCCCTGATGG - Intronic
1140013642 16:71161141-71161163 TGTCTCCCATCACCCCCAGATGG - Intronic
1140236338 16:73162361-73162383 TGTCTCCCATCACCCCCACATGG + Intergenic
1140239236 16:73186073-73186095 TGTCTCCCATCACCCCCACATGG + Intergenic
1140902914 16:79386309-79386331 TGTCTCCCATCACCCCCAGATGG - Intergenic
1140910683 16:79449042-79449064 TGTCTCCCATCACCCCCAGATGG - Intergenic
1141216067 16:82024932-82024954 TGTCTCCCATCACCCCCATATGG - Intergenic
1141231002 16:82167594-82167616 TGTCTCCCATCACACCCAGATGG - Intronic
1141281415 16:82632864-82632886 TGTCTCCCATCACCCCCAGATGG - Intronic
1141350198 16:83287584-83287606 TGTCTCCCATCACCCCCGGATGG + Intronic
1141979814 16:87543065-87543087 TGTCTCCCATCACCCCTAGATGG + Intergenic
1142448966 16:90162578-90162600 TTTCTCCCATCACGCTCAGGTGG + Intergenic
1142449367 16:90165997-90166019 TTTCTCCCATCACGCTCAGGTGG + Intergenic
1142457729 17:65884-65906 TTTCTCCCATCACGCTCAGGTGG - Intergenic
1142458130 17:69304-69326 TTTCTCCCATCACGCTCAGGTGG - Intergenic
1142458525 17:72711-72733 TTTCTCCCATCACGCTCAGGTGG - Intergenic
1142502949 17:343609-343631 TTCTTCCCAATAGCCCCAGGAGG - Intronic
1142697467 17:1641350-1641372 TGTCTCCCATCACCCCCAGATGG + Intronic
1142822808 17:2485253-2485275 TGTCTCCCATCACCCCCATATGG + Intronic
1143083935 17:4401819-4401841 TGTCTCCCATCACCCCCAGATGG + Intergenic
1143219275 17:5247924-5247946 TGTCTCCCATCACCCCCAGATGG + Intergenic
1143602034 17:7953381-7953403 TGTCTCCCATTATCCCCTGATGG - Intergenic
1143809771 17:9461843-9461865 TGTCTCCCATCACCCCCAGATGG - Intronic
1143993684 17:10988794-10988816 TTTCTCCCCTTTCCCCCACCTGG + Intergenic
1144076582 17:11724934-11724956 TGTCTCCCATCACCCCCAGTTGG - Intronic
1144427860 17:15161362-15161384 TGTCTCCCATCACCCCCAGATGG - Intergenic
1144665682 17:17100686-17100708 TGTCTCCCATCACCCTCAGATGG + Intronic
1145000697 17:19302553-19302575 TGTTTCCCATCACCCCCAGATGG + Intronic
1145009723 17:19361129-19361151 TGTCTCCCATCACACCCAGATGG + Intronic
1146159028 17:30549542-30549564 TGTCTCCCATCACCCCCAGATGG + Intergenic
1146168464 17:30612312-30612334 TGTCTCCCATCACCCACAGATGG - Intergenic
1146221432 17:31025812-31025834 TGTCTCCCATCACCCACAGATGG - Intergenic
1146315911 17:31806677-31806699 TGTCTCCCATCACCTCCAGATGG + Intergenic
1146647671 17:34585845-34585867 TTTGTCTCATTCCCCCCAGTTGG - Intronic
1146689391 17:34862775-34862797 TGTCTCCCATCACCCCCAGAGGG + Intergenic
1146721733 17:35128877-35128899 TGTCTCCCATCACCCCCAAATGG - Intronic
1146845731 17:36181006-36181028 TGTCTCCCATCACCCCCAAGTGG - Intronic
1146873949 17:36392883-36392905 TGTCTCCCATCACCCCCAAGTGG - Intronic
1147065441 17:37919990-37920012 TGTCTCCCATCACCCCCAAGTGG + Intergenic
1147538609 17:41336939-41336961 TGTCTCCCATCACCCCCAGATGG - Intergenic
1147686839 17:42291089-42291111 TGTCTCCCATCACCCCCAGATGG - Intronic
1148183983 17:45628061-45628083 TGTCTCCCATCACCCCCAGATGG - Intergenic
1148193376 17:45695844-45695866 TTTGTCCCAGAACCCCCAGGAGG - Intergenic
1148294384 17:46488268-46488290 TGTCTCCCATCACCCCCAGATGG + Intergenic
1148316567 17:46705982-46706004 TGTCTCCCATCACCCCCAGATGG + Intronic
1148559543 17:48597964-48597986 TTCCTCCTATTACCCGCCGGCGG - Exonic
1148868641 17:50642612-50642634 TCACTCCCATTACTCACAGGTGG + Intronic
1148979791 17:51562540-51562562 TGTCTTCCATCACCCCCAGATGG - Intergenic
1149002083 17:51767752-51767774 TGTCTCCCATCACCCCCAGATGG - Intronic
1149205889 17:54247480-54247502 TGTTTCTCATTACCCCCAGATGG - Intergenic
1149272065 17:54990468-54990490 TGTCTCCCCTCACCCCCAGATGG + Intronic
1149440343 17:56668706-56668728 TATCTCCCATCACCCCCAGAGGG + Intergenic
1149848931 17:60023947-60023969 TGTCTCCCATCACCCCCAGATGG - Intergenic
1149861237 17:60122577-60122599 TGTCTCCCATCACCCCCAGATGG + Intergenic
1149897597 17:60441086-60441108 TGTCTCCCATCACCCCCAGATGG - Intergenic
1150119976 17:62592846-62592868 TGTCTCCCATGACCACCAGATGG - Intronic
1150366367 17:64589694-64589716 TGTCTCCCATCACCCACAGATGG + Intronic
1150417745 17:65001177-65001199 TGTCTCCCATCAACCCCAGATGG + Intergenic
1150806723 17:68325312-68325334 TGGCTCCCATCACCCCCAGATGG + Intronic
1150826588 17:68481425-68481447 TATCTCCCATCATCCCCAGATGG - Intergenic
1150882220 17:69043059-69043081 TGTCTCCCATCACCCCCAGATGG - Intronic
1150902795 17:69300161-69300183 TGTCTCCCATCACCCCCAGATGG - Intronic
1150924282 17:69516226-69516248 TGTCTCCCATCACCCCCAGATGG - Intronic
1151019604 17:70599968-70599990 TGTCTCCCATCACCCCCAGATGG - Intergenic
1151200310 17:72463167-72463189 TGTCTCCCATCGCCCCCAGATGG + Intergenic
1151254614 17:72866293-72866315 TGCCTCCCATTACCCCCAGATGG + Intronic
1151442314 17:74138269-74138291 TGTCTCCCATCACCCCCAGATGG - Intergenic
1151506075 17:74528071-74528093 TGTCTCCCATCACCCCCAGATGG + Intronic
1151881114 17:76895229-76895251 TGTCTCCCATCACCCCCAAATGG + Intronic
1151984037 17:77530504-77530526 TGTCTCCCATCACCCCCAGATGG - Intergenic
1152003640 17:77663213-77663235 CATCTCCCATCACCCCCAGATGG + Intergenic
1152029423 17:77832550-77832572 TGTCTCCCATCACCCCCAGATGG + Intergenic
1152163765 17:78687211-78687233 TGTCTCCCATCAGCCCCAGATGG - Intronic
1152214146 17:79022826-79022848 TTTCTCCCTGTACTCACAGGAGG + Intronic
1152304094 17:79511174-79511196 TTTCTTCCCTGACCCTCAGGAGG - Intronic
1152422350 17:80200794-80200816 CGTCTCCCATCACCCCCAGATGG - Intronic
1203165405 17_GL000205v2_random:88770-88792 CATCTCCCAGTACTCCCAGGAGG + Intergenic
1153123754 18:1764526-1764548 TGTCTCCCGTCACCCCCAGATGG - Intergenic
1153342308 18:3988108-3988130 TGTCTCCCATCACCCCCAGATGG - Intronic
1153495722 18:5696774-5696796 TGTCTCCCATCACCTCCAGATGG + Intergenic
1153498949 18:5728913-5728935 TTTCTCCCACTACCCCAAGCTGG + Intergenic
1153533833 18:6078873-6078895 TGTCTCCCATCACCCCCAGATGG - Intronic
1153828213 18:8896690-8896712 TTTCTCCCTTTTCCTCCAGGGGG - Intergenic
1153845231 18:9043431-9043453 TGCCTCCCATCACCCCCAGATGG + Intergenic
1154143051 18:11842536-11842558 TGTCTCCCATCACCCCCAGATGG - Intronic
1154958910 18:21288287-21288309 TCACACCCATTTCCCCCAGGTGG - Intronic
1155107986 18:22686698-22686720 TGTCTCCCATCACCCCCAGATGG - Intergenic
1155366982 18:25058541-25058563 TGTCTCCCATCACCCCCAGATGG - Intergenic
1155394150 18:25368431-25368453 TGTCTCTCATCACCCCCAGATGG - Intergenic
1155668757 18:28344031-28344053 TGTCTCCCATCACCCCCAGATGG - Intergenic
1155733880 18:29197138-29197160 TGTCTCCCATCACCCCCATGTGG - Intergenic
1155887293 18:31223803-31223825 TGTCTCCCATCACCCCCAGATGG + Intergenic
1155914207 18:31540000-31540022 TGTCTCCCATCACCCCCAGATGG + Intronic
1156009618 18:32481454-32481476 TCACTGTCATTACCCCCAGGTGG - Intergenic
1156033687 18:32742833-32742855 TTTCTACCTTCTCCCCCAGGGGG + Intronic
1156034081 18:32747423-32747445 TGTCTCCCATCACCCCCAGATGG - Intronic
1156151966 18:34253333-34253355 TGTCTCCCATCACCCCTAGATGG + Intergenic
1156536519 18:37869830-37869852 TGTCTCCCATCACCCCCAGGTGG - Intergenic
1156546755 18:37971111-37971133 TTGCTCCCAATATCTCCAGGGGG + Intergenic
1156623058 18:38875554-38875576 TGTCTCCCATTACCCACAGATGG + Intergenic
1156789807 18:40957126-40957148 TTTCTCCCAATGACTCCAGGAGG - Intergenic
1157375645 18:47161869-47161891 TGTCTCCCATCATCCCCAGTTGG - Intronic
1157538620 18:48482120-48482142 TGTCTCCCATTATCCCTAGATGG - Intergenic
1157769010 18:50327988-50328010 TGTCTCCCATCACCCCCAGATGG - Intergenic
1157795768 18:50573537-50573559 TGTCTCCCATCACCCCCAGATGG + Intronic
1158070288 18:53462461-53462483 TGTCTCCCATAACCCCCAGATGG + Intronic
1158193244 18:54855073-54855095 TGTCTCCCATCACCCCCAGATGG - Intronic
1158195593 18:54881716-54881738 TATCCCCCATTTCCCCCACGGGG - Intronic
1158289518 18:55923562-55923584 TGTCTCCCATCACCCCCAGATGG - Intergenic
1158430238 18:57378653-57378675 TCTCTCCCATGACCCTAAGGAGG + Intergenic
1158480882 18:57820883-57820905 TGTCTCCCATCACCCCCAGATGG + Intergenic
1158763105 18:60414142-60414164 TGTCTCCCATCACCCCTAGATGG - Intergenic
1159300678 18:66562298-66562320 TGTCTCCCATCACTGCCAGGTGG - Intronic
1159381952 18:67671502-67671524 TGTCTCCCATCACTCCCAGATGG - Intergenic
1159524401 18:69568866-69568888 TGTCTCCCATCACCCCCAGATGG + Intronic
1159543789 18:69814405-69814427 TGTCTCCCATCACCTCCAGATGG - Intronic
1159558341 18:69968030-69968052 TGTCTCCCATCACCCACAGATGG - Intergenic
1159573355 18:70145187-70145209 TGTCTCCCATTACCCCCACATGG + Intronic
1159670883 18:71219238-71219260 TGTCTCCCATCACCCCCAGATGG - Intergenic
1159937292 18:74379417-74379439 TATCTCCCATCACCCCTAGTTGG - Intergenic
1159944314 18:74432507-74432529 TGTCTCCCATCACCCCCAGATGG + Intergenic
1160271313 18:77386844-77386866 TGTCTCCCATCACCCCCAGATGG + Intergenic
1160281369 18:77493874-77493896 GGTCTCCCATCACCCCCAGACGG + Intergenic
1160334277 18:78023663-78023685 TGTCTCCCATCACCCCCAGATGG - Intergenic
1160369118 18:78356625-78356647 TGTCTCCCATCACCCCCAGATGG - Intergenic
1160412125 18:78682259-78682281 TGCCTCCCATTACCCCCAGATGG + Intergenic
1160430803 18:78811371-78811393 TGTCTCCCATCACCCCTAGATGG - Intergenic
1160609827 18:80076326-80076348 TGTCTCCCATCACCCCAAGATGG + Intronic
1160647842 19:201810-201832 TTTCTCCCATCACGCTCAGGTGG - Intergenic
1160648240 19:205224-205246 TTTCTCCCATCACGCTCAGGTGG - Intergenic
1161125222 19:2552347-2552369 TGTCTCCCATCACCTCCAGATGG + Intronic
1161202906 19:3025757-3025779 TGTCTCCTATTCCCACCAGGAGG + Intronic
1161269879 19:3383926-3383948 TTACTCCCATTGCACCAAGGAGG - Intronic
1161565278 19:4998423-4998445 TTTCACCCAGGACCCCCATGTGG + Intronic
1161788742 19:6345517-6345539 TGTCTCCCATCACCCCCAGCTGG - Intergenic
1161862315 19:6807304-6807326 TGTCTCCCATCACCCCCAGATGG - Intronic
1161907806 19:7170279-7170301 TGTCTCCCATCACCCCCAGCTGG + Intronic
1161976306 19:7609743-7609765 TGTCTCTCATCACCCCCAGCTGG - Intronic
1161988834 19:7672457-7672479 TGTCTCCCATCACCCTCAGCTGG - Intergenic
1161997436 19:7722160-7722182 TGTCTCCCATCACCCCCAGATGG - Intergenic
1162004834 19:7771054-7771076 TGTCTCTCATCACCCCCAGATGG - Intergenic
1162175394 19:8826423-8826445 TGTCTCCCATCACCCCCAGATGG - Intronic
1162218044 19:9152607-9152629 TGTCTCCCATCACCTCCAGATGG + Intronic
1162618677 19:11822251-11822273 TTTCTCCCAGTTCCTCCATGTGG - Intronic
1162684467 19:12370211-12370233 TGTCTCCCACCACCCCCAGAAGG - Intergenic
1162726175 19:12690850-12690872 CTTCCCCCATTAACCCCATGGGG + Intronic
1163208282 19:15820585-15820607 TGTCTCCCATCACCCTCAGATGG - Intergenic
1163348016 19:16756986-16757008 TGTCTCCCATCACCCCCAGATGG + Intronic
1163384146 19:16989020-16989042 TGTCTCCCACCACCCCCAGACGG + Intronic
1163388839 19:17017220-17017242 TGTCTCACATCACCCCCAGGTGG + Intronic
1163542026 19:17917363-17917385 TGTCTCCCATCACTCCCAGATGG + Intergenic
1163744635 19:19038141-19038163 TATCTCCCATCACCCCCAGATGG + Intronic
1164579688 19:29427006-29427028 TGTCTCCCATCACCCCAAGATGG + Intergenic
1164775013 19:30846137-30846159 TGTCTCCCATCACCCCGAGATGG - Intergenic
1164794018 19:31011905-31011927 TGTCTCCCATCACCCCCAGATGG + Intergenic
1165053662 19:33159918-33159940 TGTCTCCCATCACCCCCAGATGG - Intronic
1165054414 19:33164968-33164990 TGTCTCCCATCACCCCCAGATGG - Intronic
1165210342 19:34230872-34230894 TGTCTCCCATCACCCCCAGATGG - Intergenic
1165242453 19:34479719-34479741 TGTCTCCCATCACCCCCAGATGG + Intergenic
1165358053 19:35316203-35316225 TGTCTCCCATCACCCCCGGATGG + Intergenic
1165410427 19:35657213-35657235 TATCTCCCATCACCCCCAGATGG - Intronic
1165671101 19:37680080-37680102 TGTCTCTCATCACCCCCAGATGG - Intronic
1165683970 19:37802076-37802098 TGTTTCCCATCACCCCCAGATGG - Intronic
1165779248 19:38422676-38422698 TGTCTCTCATCACCCCCAGATGG + Intronic
1165988579 19:39792286-39792308 TGTCTCCCATCACCCCCAGATGG - Intergenic
1166572465 19:43806326-43806348 TGTCTCCCATCACCCCTAGAGGG + Intronic
1166577677 19:43857807-43857829 TGTCTCCCATCACCCCCAGATGG + Intergenic
1167223175 19:48216974-48216996 TGTCTCCCATCACCCCGAGATGG - Intronic
1167224444 19:48228149-48228171 TGTCTCCCATTACCCCCAGATGG + Intronic
1167617023 19:50540760-50540782 TGTCTCCCATCACCCCCAGATGG + Intronic
1167802462 19:51753453-51753475 TGTCTCCCATCACTCCCAGATGG + Intronic
1167819909 19:51918205-51918227 TGTCTCCCATCACCCCCAGCTGG - Intronic
1168507979 19:56952281-56952303 TGTCTCCCATCACTCCCAGCTGG - Intergenic
925198360 2:1946210-1946232 TGTCTCCCATCACACCCAGATGG + Intronic
925665095 2:6244930-6244952 TGTCTCCCATTATCCCCAGATGG + Intergenic
925666996 2:6268385-6268407 TGTCTCCCATCACCTCCAGATGG + Intergenic
925801340 2:7604933-7604955 TGTCTCCCATCACCCCCAGGTGG - Intergenic
925825229 2:7841749-7841771 TGTCTCCCATCACCCCCAGATGG - Intergenic
925891454 2:8438336-8438358 TGTCTCCCATCACCCCCAGATGG + Intergenic
926374748 2:12215399-12215421 TGTCTCCCATTGCCCTCAGATGG + Intergenic
926572505 2:14544797-14544819 TGTTTCCCATCACCCCCAGAAGG - Intergenic
926823553 2:16879901-16879923 TGTCTCCCATCACCCCCAGATGG - Intergenic
926846980 2:17152193-17152215 TGTCTCCCATCACCCCCATATGG - Intergenic
927244215 2:20943772-20943794 TGTCTCCCATCACCCCCAGATGG - Intergenic
927341597 2:21989830-21989852 TGTCTCCCATCACCCCCAGATGG + Intergenic
928163266 2:28949634-28949656 TGTCTCCTATCACCCCCAGATGG - Intergenic
928239838 2:29576852-29576874 TGTCTCCCACCACCCCCAGATGG + Intronic
928711751 2:34014966-34014988 TGTCTCCCATCATCCCCAGAAGG - Intergenic
929111122 2:38405985-38406007 TCTCTCCTATCACCCCCAGATGG - Intergenic
929174657 2:38964063-38964085 TCTCACCCATCACCCCCAGATGG - Intronic
929239918 2:39643453-39643475 TGTCTCCCATCACCTCCAGATGG + Intergenic
929524098 2:42683621-42683643 TATCTCCCATTACCCCCAGATGG - Intronic
929762682 2:44819083-44819105 TGTCTCCCACCACCCCCAGATGG - Intergenic
930040427 2:47118355-47118377 TGTCTCCCATCACCCCCAGATGG + Intronic
931341952 2:61410245-61410267 TGTCTCCTATCACCCCCAGATGG - Intronic
931597841 2:63969532-63969554 TGTCTCCCATCTCCCCCAGATGG + Intronic
931650637 2:64465727-64465749 TGTCTCCCATCACCCCCAGATGG - Intergenic
931909353 2:66879990-66880012 TGTCTCCTATCACCCCCAGATGG + Intergenic
932436904 2:71707223-71707245 GATCTCCCATCTCCCCCAGGAGG - Intergenic
932592449 2:73075496-73075518 TTCCTCACCCTACCCCCAGGAGG - Exonic
932605200 2:73160744-73160766 TGTCTCCCATCACCTCCAGATGG - Intergenic
932725351 2:74175222-74175244 TCTCTCCCATTACCCCCAGATGG + Intronic
933006140 2:76997962-76997984 TGTCTCCCATCACCCCAAGATGG + Intronic
933227831 2:79771532-79771554 TGTCTCCCATCACCCCCAGATGG - Intronic
933310746 2:80658628-80658650 TATCTCCCATCATCCCCAGATGG + Intergenic
934155962 2:89200801-89200823 TGTCTCCCATCACCCCCAGATGG + Intergenic
934211360 2:89981960-89981982 TGTCTCCCATCACCCCCAGATGG - Intergenic
934660668 2:96142021-96142043 TGTCTCCCATCACTCCCAGATGG - Intergenic
934740995 2:96722385-96722407 TGTCTCCCATCACCCCCAGATGG - Intronic
935096530 2:99949568-99949590 TGTCTCCCATCAACCCCAGATGG - Intronic
935111017 2:100094338-100094360 TGTCTCCCATCACCCCCAGATGG - Intronic
935294333 2:101635684-101635706 TGTCTCCCATCACCTCCAGATGG + Intergenic
935359790 2:102237549-102237571 TTTCTCCTATTGCACCCAAGAGG - Intronic
935423405 2:102894263-102894285 TGTCTCCCATCACCTCCAGATGG + Intergenic
935682595 2:105651053-105651075 TGTCTCCCATCACCCCCAGATGG - Intergenic
935870968 2:107449427-107449449 TGTCTCTCATCACCCCCAGGTGG - Intergenic
936123961 2:109770824-109770846 TGTCTCCCATCACCCCCAGATGG + Intergenic
936220728 2:110600640-110600662 TGTCTCCCATCACCCCCAGATGG - Intergenic
936957927 2:118041652-118041674 TCTCTGCCATTACCCCCACTGGG + Intergenic
937018053 2:118624375-118624397 TCTCTCCCATCACCCCCAGATGG + Intergenic
937165884 2:119816660-119816682 TGTCTACCATCACCCCCAGATGG - Intronic
937483389 2:122287493-122287515 TGTCTCCCATCACCCCCAGATGG + Intergenic
937576936 2:123435087-123435109 TATCTCCCATCACCTCCAGATGG - Intergenic
937836781 2:126479284-126479306 AGTCTCCCATCACCCCCAGATGG + Intergenic
937850353 2:126626851-126626873 TGTCTCCCATCACTCCCAGATGG - Intergenic
937902738 2:127034400-127034422 TCTCTCCCATCACCCCCAGATGG + Intergenic
938552894 2:132397041-132397063 TGTCTCCCATCACCCCCAGATGG - Intergenic
938672317 2:133597982-133598004 TTTCTCCCAGTTTACCCAGGTGG - Intergenic
938684163 2:133720727-133720749 TGTCTCCCATCACTCCCAGATGG - Intergenic
938943667 2:136191393-136191415 TGTCTCCCATTACCCCCAGATGG + Intergenic
939085189 2:137709923-137709945 TGTCTCCAATTTACCCCAGGTGG - Intergenic
939138141 2:138321478-138321500 TGTCTCCCATCACCCCCAGATGG - Intergenic
939547477 2:143571137-143571159 TGTCTCCCATAACCCCCAAATGG + Intronic
939631705 2:144533669-144533691 TATCTCCCATCACCCCCAGATGG + Intergenic
940453290 2:153867715-153867737 TATCTCCCATCACCCCCAGATGG - Intergenic
940570554 2:155427570-155427592 TTTCTCCCACTATCTCCAGAAGG + Intergenic
940623921 2:156149106-156149128 TGTCTCCCATCACCCCCAGATGG + Intergenic
940722243 2:157294652-157294674 TTTCCCCCATGAGCCCCAGTAGG + Intronic
940948867 2:159649289-159649311 TGTCTCCCATCACCCCCAGATGG - Intergenic
941509014 2:166382838-166382860 TGTCTCCCATCACCCCCAGATGG + Intergenic
941621950 2:167788439-167788461 TGTCTCCCATCACCCCCAGATGG - Intergenic
941841670 2:170091825-170091847 TGTTTCCCATCACCCCCAGATGG + Intergenic
941874439 2:170418710-170418732 ACTCTCCCTTTGCCCCCAGGTGG - Intronic
942338784 2:174920911-174920933 TGTCTCCCATCACCCCCAGATGG - Intronic
942479492 2:176368709-176368731 TGTCTCCCATCACTCCCAGAAGG + Intergenic
942559144 2:177201839-177201861 TGTCTCCCATCACCCCCATATGG - Intergenic
943058900 2:183017376-183017398 CGTCTCCCATCACCCCCAGATGG - Intronic
943576225 2:189633895-189633917 TGTCTCCCATCACCCCCAGATGG + Intergenic
943581943 2:189694371-189694393 TTCCTCCCCTTCCCCCCATGAGG - Intronic
943818686 2:192290366-192290388 TGTCTCCCATCACCCCCAGATGG - Intergenic
943979472 2:194529637-194529659 CATCTCCCATCACCCCCAGATGG - Intergenic
943991438 2:194698391-194698413 TGTCTCCCATCACCCACAGATGG + Intergenic
944170713 2:196773723-196773745 TGTCTCCCATCACCCCCAGATGG - Intronic
944290766 2:198001933-198001955 TGTCTCCTATCACCCCCAGATGG + Intronic
944612546 2:201426330-201426352 TCTCTCCCATCACCTCCAGAAGG + Intronic
944886134 2:204064456-204064478 TGTCTCCCATCACCCCCATATGG + Intergenic
944917275 2:204373915-204373937 TGTCTCCCATCACCCCTACGTGG - Intergenic
945027445 2:205632562-205632584 TGTCTCCCATCACCCCAAGATGG + Intergenic
945057919 2:205884342-205884364 TGTCTCCCATCACCCCCAGATGG + Intergenic
945157353 2:206853438-206853460 TGTCTCCCATCACCCCTAGATGG + Intergenic
945933470 2:215879979-215880001 TGTCTCCCATTGCCCCCAGATGG - Intergenic
946099662 2:217309014-217309036 TGTCTCCCATCACCCCCAGATGG - Intronic
946288902 2:218728322-218728344 TATCTTCCATCACCCCCAGATGG - Intronic
946296146 2:218785119-218785141 TGTCTCCCATCACCCCCAGATGG - Intronic
946785632 2:223240663-223240685 TGTCTCCCATCACCCCCAGTAGG - Intergenic
946995023 2:225381658-225381680 TGTCTCCCATCATCCCCAGATGG - Intergenic
947201761 2:227620545-227620567 TGTCTCTCATCACCCCCAGATGG + Intronic
947287221 2:228530282-228530304 CGTCTCCCATCACCCCCAGATGG + Intergenic
947482433 2:230512852-230512874 TGTCTCCCATCACCCCTAGATGG - Intronic
947609150 2:231512218-231512240 TGTCTCCCATCACCCCCAGATGG - Intergenic
947751847 2:232536853-232536875 TTTAACCCATTTCCCTCAGGGGG + Intergenic
947973187 2:234341946-234341968 TGTCTCCCATCAGCCCCAGATGG + Intergenic
948014699 2:234678518-234678540 TGTCTCCCATCACCCCTAGATGG + Intergenic
948017252 2:234700828-234700850 TTTTACGCATGACCCCCAGGAGG - Intergenic
948063052 2:235056100-235056122 TTCCTCCCCCTACCTCCAGGTGG - Intergenic
948085777 2:235245825-235245847 TATCTCGCATCACCCCCAGATGG - Intergenic
948394913 2:237638211-237638233 TGTCTCCCATCACCCCCAGATGG - Intronic
948535768 2:238645496-238645518 TGTCTCCCATCACTCCCAGATGG + Intergenic
948734718 2:239994446-239994468 TGTCTCCCATCACCCCCAGATGG + Intronic
1169166703 20:3430322-3430344 TGTCTCCCATCACCCCCAGATGG - Intergenic
1169318889 20:4614839-4614861 TTTCTTCCATCTGCCCCAGGTGG + Intergenic
1169707187 20:8518848-8518870 TGTCTTCCATCACCCCCAGATGG - Intronic
1170645483 20:18193454-18193476 TGTCTCCCATCACCCCAAGATGG - Intergenic
1170789771 20:19498143-19498165 TGTCTCTCATCACCCCCAGATGG + Intronic
1170833785 20:19866113-19866135 TGTCTCCCATCACCCCCAGATGG - Intergenic
1171218651 20:23373394-23373416 TGTCTTCCATCACCCCCAGATGG - Intergenic
1171406595 20:24915926-24915948 TTTCTCCCTTGAACTCCAGGTGG - Intergenic
1172018880 20:31898632-31898654 TTTCTCCCAGTTCCCCTGGGTGG + Intronic
1172678539 20:36693753-36693775 TGTCTCCCATCACCCCCACATGG + Intronic
1172757099 20:37293307-37293329 TGTCTCCCATCACCCCCAGACGG - Intronic
1172801259 20:37577853-37577875 TGTCTCCCATCACCCCCAGATGG + Intergenic
1173204412 20:40981337-40981359 TGTCTCCCATCATCCCCAGATGG + Intergenic
1173466700 20:43288578-43288600 TGTCTCCCGTCACCCCCAGATGG - Intergenic
1173926037 20:46781993-46782015 TGTCTCCCATCACCCCCAGATGG - Intergenic
1173979490 20:47212213-47212235 TTTCTTCCAGTACCCGCTGGTGG - Intronic
1174030792 20:47624342-47624364 TTTCTCCCATTACCCCCAGATGG - Intronic
1174142845 20:48428632-48428654 CATCTCCCATCACCCCCAGATGG - Intergenic
1174194871 20:48766049-48766071 TGTCTCCCATCACCCCCAGATGG + Intronic
1174290238 20:49503215-49503237 TGTCTCCCATCACCCCCAGATGG - Intergenic
1174427891 20:50446137-50446159 TGTCTCCCATCACCCTCAGATGG + Intergenic
1174635561 20:51996455-51996477 TGTCTCCCATCACCCCCAGATGG - Intergenic
1174679019 20:52386503-52386525 TGTCTCCCATCACCCTCAGATGG + Intergenic
1174795317 20:53517485-53517507 TGTCTCCCATCACCCTCAGATGG + Intergenic
1174868914 20:54165342-54165364 TGTCTCCCATCACCCCCAGATGG + Intronic
1175234363 20:57499682-57499704 TGTCTCCCATCACCCCCAGATGG - Intronic
1175492023 20:59385669-59385691 TTCCTCCCATTGGCCCTAGGAGG - Intergenic
1175495189 20:59409476-59409498 TGTCTCCCATCATCCCCAGATGG + Intergenic
1175577653 20:60074223-60074245 TGTCTCCCATCACCCCCAAATGG - Intergenic
1175665931 20:60860064-60860086 CTTCTCCCATCACCTCCAGATGG - Intergenic
1175694974 20:61095649-61095671 TGTCTCCCATCACCCCCAGATGG - Intergenic
1175729261 20:61342382-61342404 TGTCTCCCATCACCTCCAGATGG - Intronic
1176336282 21:5602681-5602703 CATCTCCCAGTACGCCCAGGAGG - Intergenic
1176391475 21:6218267-6218289 CATCTCCCAGTACGCCCAGGAGG + Intergenic
1176406347 21:6370309-6370331 CATCTCCCAGTACTCCCAGGAGG - Intergenic
1176411138 21:6450234-6450256 TCTCTCCCCTGACCTCCAGGTGG + Intergenic
1176469944 21:7097907-7097929 CATCTCCCAGTACGCCCAGGAGG - Intergenic
1176493505 21:7479685-7479707 CATCTCCCAGTACGCCCAGGAGG - Intergenic
1176507137 21:7658698-7658720 CATCTCCCAGTACGCCCAGGAGG + Intergenic
1176516638 21:7789244-7789266 TTCCGCCCTTTGCCCCCAGGTGG + Intergenic
1177146264 21:17410416-17410438 AGTCTCCCATCACCCCCAGACGG + Intergenic
1177296949 21:19187965-19187987 TGTCTCCCATCACTCCCAGATGG + Intergenic
1177724019 21:24943977-24943999 TGTCTCCCATCAGCCCCAGATGG - Intergenic
1177805233 21:25868717-25868739 TGTCTCCCATCACCCCCAGATGG - Intergenic
1177993852 21:28071774-28071796 TGTCTCCCATCACCCCCACATGG - Intergenic
1178319749 21:31596405-31596427 TGTCTCCCATGACCCCCAGATGG + Intergenic
1178415955 21:32405294-32405316 TGTCTCCCATCACCCCCAGATGG - Intergenic
1178458357 21:32777099-32777121 TGTCTCCCATCACCCCCAGATGG + Intergenic
1178462395 21:32814890-32814912 TGTCTCCCATCACCCCTAGATGG + Intergenic
1178533798 21:33396366-33396388 TGTCTCCCATCACCCCCAGAAGG + Intergenic
1178596471 21:33957844-33957866 TGTCTCCCATCACCCCCAGATGG - Intergenic
1178650666 21:34419256-34419278 TTCCGCCCTTTGCCCCCAGGTGG + Exonic
1178672952 21:34608042-34608064 TGTCTCCCATCAGCCCCAGATGG + Intronic
1179186540 21:39089387-39089409 TGTCTCCCATCACCCTCAGATGG - Intergenic
1179405566 21:41122614-41122636 TGTCTCCCATCTCCCCCAGATGG - Intergenic
1179598054 21:42456414-42456436 TGTCTCCCATCACCCCCAGATGG - Intergenic
1179686631 21:43058556-43058578 TCTCTCCCCTGACCTCCAGGTGG + Intronic
1179949450 21:44701563-44701585 TGTCTCCCATCACCCCCAGACGG - Intronic
1180476893 22:15719273-15719295 CATCTCCCATCACCCCCAGATGG + Intronic
1180936161 22:19626550-19626572 TGTCTCCCATCGCCCCCAGATGG + Intergenic
1181780586 22:25190193-25190215 TGTCTCCCGTCACCCCCAGATGG - Intronic
1181829594 22:25549424-25549446 TGTCTCCCATCACCCCCAGATGG + Intergenic
1181972321 22:26700356-26700378 TATCTCCCATCACCCCCAGATGG + Intergenic
1182202199 22:28585327-28585349 TGTCTCCCATCACCCCCAGATGG - Intronic
1182363530 22:29762610-29762632 TGTCTCCCATCACCCCCAGATGG + Intronic
1182745167 22:32600192-32600214 TGTCTCCCATCACCCCCAGATGG - Intronic
1182752858 22:32655677-32655699 TGTCTCCCATCACCCCCAGATGG + Intronic
1182879350 22:33720187-33720209 TGTCTCCCATCACCCCCAGATGG - Intronic
1182974471 22:34610180-34610202 TGTCTCCCATCACCCCCAGATGG + Intergenic
1183051990 22:35270326-35270348 TGTCTCCCATCACCCCCAGATGG + Intronic
1183160327 22:36108994-36109016 TGTCTCCCATCACTCCCAGATGG - Intergenic
1183502805 22:38191060-38191082 TGTCTCCCATCACCCCCAGATGG - Intronic
1183653716 22:39173372-39173394 TCTGGCCCATTTCCCCCAGGTGG + Intergenic
1183945467 22:41323447-41323469 GTTCTCCCATTTCCCCTACGGGG + Intronic
1184154732 22:42659913-42659935 TGTCTCCCATCACCCCCAAATGG + Intergenic
1184932974 22:47695156-47695178 TGTCTCCCATCACCCCTAGATGG - Intergenic
1184951916 22:47849260-47849282 TGTCTCCAATCACCCCCAGATGG + Intergenic
1185189476 22:49425376-49425398 TGTCTCCCATCACCCTCAGATGG - Intronic
1185304254 22:50104031-50104053 TGTCTCCCATCACCCCCAGATGG - Intronic
949193300 3:1275663-1275685 TGTCTCCCATCACCCCCAAATGG - Intronic
949361632 3:3238314-3238336 TGTCTTCCATCACCCCCAGATGG + Intergenic
949378493 3:3417304-3417326 TGTCTCCCATTACCCCCAGATGG + Intergenic
949475499 3:4441294-4441316 TGTCTCCCATCACCCCCAGATGG + Intronic
949564286 3:5230663-5230685 TGTCTCCCACCACCCCCAGATGG + Intergenic
949668568 3:6370575-6370597 TGTCTCTCATCACCCCCAGATGG + Intergenic
950294940 3:11821336-11821358 TGTCTCCCATCACCCCCAGAGGG - Intronic
950374838 3:12562819-12562841 TGTCTCCCATGACCCCCAGATGG + Intronic
950589023 3:13922096-13922118 TGTCTCCCATCACCCCTAGATGG - Intergenic
950758425 3:15197903-15197925 TGTCTTCCATCACCCCCAGATGG - Intergenic
950809364 3:15636438-15636460 TTTCCCTCTTTGCCCCCAGGGGG - Intronic
951043593 3:18014312-18014334 TGTCTCCCATACCCCCCAGATGG + Intronic
951221378 3:20072056-20072078 TTGCTACCATTGCCCCCAGTGGG - Intronic
951493864 3:23303188-23303210 TGTCTCCCGTCACCCCCAGATGG + Intronic
951509956 3:23489330-23489352 TGTCTCCCATCACCCACAGATGG - Intronic
951973580 3:28476781-28476803 TGTCTCCCATCACCCCCAGATGG - Intronic
952373560 3:32746445-32746467 TGTCTCCCATCACCCCCACATGG - Intronic
952435955 3:33272694-33272716 TGCCTCCCATCACCCCCAGATGG + Intergenic
952796245 3:37241936-37241958 TGTCTCCCATCACCCCCAGATGG - Intergenic
952799031 3:37270949-37270971 TGTCTCCCATCACCCTCAGAAGG - Intronic
952799154 3:37272006-37272028 TGTCTCCCATCACCCCCAGATGG + Intronic
952834607 3:37592408-37592430 TTTCTCCTCCTGCCCCCAGGAGG - Intronic
953066193 3:39473295-39473317 TTTTACCCATCACTCCCAGGAGG + Intronic
953531820 3:43746344-43746366 TCACTCCCATCACCCCCAGATGG - Intergenic
953602753 3:44384461-44384483 ATTATCCTATTACCCCCATGAGG - Intronic
953706996 3:45238712-45238734 TGTCTCCCATCACCCCCAGATGG + Intergenic
953806795 3:46077405-46077427 TGTCTCCCATCACCTCCAGATGG + Intergenic
953872581 3:46640129-46640151 TGTCTCCCATCACCCCCAGATGG - Intergenic
954160735 3:48719860-48719882 TTTCTTCCATTAGACCCAAGTGG - Intronic
955291990 3:57700764-57700786 TGTCTTCCATCACCCCCAGATGG - Intergenic
955572805 3:60326320-60326342 TGTCTCCCATCACCCCCAGATGG - Intronic
955698877 3:61663717-61663739 TGTCTCCCATTACCCTCAGATGG - Intronic
955897615 3:63717410-63717432 TATCTCCTAGAACCCCCAGGAGG - Intergenic
955905545 3:63803942-63803964 TGTCTCCCATCACCCCCAGATGG - Intergenic
955935930 3:64102497-64102519 TGTCTCCCATTACCCCTAGATGG + Intronic
956283161 3:67580542-67580564 TCTCTCCCAGTGCCCCGAGGAGG - Intronic
956327978 3:68074068-68074090 TGTCTCCCATCACCCGCAGATGG - Intronic
956393520 3:68800028-68800050 TGTCTCCCATTGCCCCCAAATGG + Intronic
956438663 3:69259131-69259153 TGTCTCCCATCACCCCCAGGTGG - Intronic
956601623 3:71028808-71028830 TGTCTCCCATTACCCCCACATGG - Intronic
956647863 3:71474697-71474719 TGTCTCCCATCAACCCCAGATGG + Intronic
956695184 3:71912701-71912723 TGTCTCCCATCACCCCCACATGG - Intergenic
956699116 3:71943162-71943184 TTTCTCCCATAACCCCAAGATGG + Intergenic
956917824 3:73891683-73891705 TGTCTCCCATCACCTCCAGATGG - Intergenic
956959094 3:74376515-74376537 TGTCTCCCATCACCCCTAGATGG + Intronic
957503617 3:81091056-81091078 TGTCTCCCATCACCCCCAGATGG - Intergenic
957613779 3:82503246-82503268 TGTCTCCCATCACCCCCAGATGG - Intergenic
957724229 3:84044214-84044236 TGTCTCCCATCACCCCCAGATGG - Intergenic
957992500 3:87645049-87645071 TGTCTCCCATCACCCCTAGATGG + Intergenic
958056491 3:88419051-88419073 TGTCTCCCATCACCCCCAGATGG + Intergenic
958849549 3:99307492-99307514 TGTCTCCCATTATCCCCAGATGG + Intergenic
959045036 3:101464573-101464595 TGTCTCCCATCACCTCCAGATGG + Intronic
959106550 3:102071330-102071352 TGTCTCCCATCACCCCCAGATGG - Intergenic
959270777 3:104207282-104207304 CTTCTGCCATCACCCCCAGATGG + Intergenic
959386459 3:105714455-105714477 TGTCTCCCATCACCCCTAGATGG - Intronic
959394483 3:105820088-105820110 TGTGTCCCATCACCCCCAGATGG - Intronic
959577295 3:107948206-107948228 TATCTCCCATCACCCCCAGATGG + Intergenic
959644104 3:108678178-108678200 TGTCTCCCATCACCCCCAGATGG + Intronic
959850660 3:111082853-111082875 TATCTCCCATCACCCCCAGACGG - Intronic
959890885 3:111554881-111554903 TGTTTCCCATCACCCCCAGATGG - Intronic
959923105 3:111891470-111891492 TGTCTCCCATCACTCCCAGATGG + Intronic
960908971 3:122629748-122629770 TGTCTCCCATCACCCCCAGATGG - Intronic
961031780 3:123611764-123611786 TGTCTCCCATCACCCCTAGATGG - Intronic
961190503 3:124957203-124957225 TTTGTTCCAAGACCCCCAGGTGG + Intergenic
961580832 3:127880658-127880680 CTTCTCCCATCACCCCCAGATGG - Intergenic
962285465 3:134082437-134082459 TGTCTCCCATCACCCCCAGATGG + Intronic
962519673 3:136186661-136186683 TGTCTCCCATCACCCCCAGATGG + Intronic
962549317 3:136473173-136473195 TGTCTCCCATCACCCCTAGATGG + Intronic
962629113 3:137258158-137258180 GTTCTCCCAATAGCCCAAGGAGG + Intergenic
963147314 3:142007692-142007714 TATCTCCCATCACTCCCAGATGG - Intronic
963233777 3:142935822-142935844 TGTCTCCCATCACCCACAGATGG + Intergenic
963536766 3:146539161-146539183 TGTCTCCCATCACCCCCACATGG - Intronic
963624840 3:147658421-147658443 TGTCTCCCATCACCCCCAGATGG - Intergenic
964165826 3:153704159-153704181 TGTCTCCTATCACCCCCAGATGG - Intergenic
964583093 3:158261778-158261800 TGTCTCCCATCACCACCAGATGG + Intronic
964791992 3:160460989-160461011 TGTCTCCCATCATCCCCAGATGG + Intronic
965450510 3:168832706-168832728 TGTCTCCCATCACTCCCAGATGG + Intergenic
965971193 3:174558487-174558509 TGTCTCCCATCACCCCCAGATGG - Intronic
966358456 3:179107622-179107644 TATCTCCCATCACCCCCAGTTGG - Intergenic
966496885 3:180590824-180590846 TGTCTCCCATCATCCCCAGAGGG + Intergenic
966533638 3:181007612-181007634 TGTCTCCCATCACCCCCAGATGG + Intergenic
966584252 3:181603880-181603902 TGTCTCCCATCACCTCCAGATGG - Intergenic
967002119 3:185345659-185345681 TGTCTCCCATCACCTCCAGATGG + Intronic
967361268 3:188634715-188634737 TGTCTCCCATCATCCCCAGATGG + Intronic
967658969 3:192081969-192081991 TGTCTCCCATGACCCCCAGATGG - Intergenic
968085332 3:195871551-195871573 CTTCTCCCATGACCCCCCTGTGG - Intronic
968331514 3:197874418-197874440 TGTCTCCCATCATCCCCAGATGG + Intronic
968369606 3:198214891-198214913 TTTCTCCCATCACGCTCAGGTGG + Intergenic
968370005 3:198218305-198218327 TTTCTCCCATCACGCTCAGGTGG + Intergenic
968789531 4:2650038-2650060 TGTCTCCCATCACCCCTAGATGG + Intronic
968983319 4:3862687-3862709 TTGCTCCCATTTCCCAGAGGAGG + Intergenic
969641359 4:8400995-8401017 TGCCTCCCATCACCCCCAGATGG - Intronic
969674476 4:8607371-8607393 CTTCTCCAAGCACCCCCAGGAGG + Exonic
970051448 4:11919132-11919154 TGTCTCCCATCACCCCTAGATGG + Intergenic
970760244 4:19476803-19476825 TGTCTCCCATCACCCCCAGATGG + Intergenic
970869068 4:20793776-20793798 TATCTCCCATCACCCTCAGATGG - Intronic
970889803 4:21030314-21030336 CATCTCCCATTACCCTCAGATGG + Intronic
971483752 4:27138911-27138933 TGTCTCCCATCACCCCCAGATGG + Intergenic
971844868 4:31906073-31906095 TTTCTCACAGTTCCACCAGGCGG + Intergenic
971879493 4:32351735-32351757 TGTCTCCCATCATCCCCAGATGG - Intergenic
971941676 4:33223817-33223839 TGTCTCCCCTCACCCCCAGATGG - Intergenic
972157860 4:36186806-36186828 TGTCTCCCATCAGCCCCAGATGG + Intronic
972168928 4:36321497-36321519 TGTCTCCCATCACCCCCAGCTGG + Intronic
972187230 4:36544937-36544959 TGTCTCCCATCACCCTCAGATGG - Intergenic
972362529 4:38341040-38341062 TGTCTCCCATCACTCCCAGATGG + Intergenic
972419889 4:38877352-38877374 TGTCTCCCATCATCCCCAGGTGG - Intronic
972536920 4:40007554-40007576 TGTCTCCCATCACCCCCAGATGG - Intergenic
972600772 4:40570337-40570359 TGTCTCCCATCACCCCCAGATGG - Intronic
972660464 4:41111000-41111022 TGTCTCCCATCACCCCCAGATGG - Intronic
972663417 4:41140849-41140871 TGTCTCCCATCATCCCCAGATGG + Intronic
972667806 4:41184000-41184022 TGTCTCCCATCACTCCCAGATGG - Intronic
972956294 4:44396093-44396115 TGTCTCTCATCACCCCCAGATGG - Intronic
973037628 4:45426022-45426044 TGTCTCTCATCACCCCCAGATGG - Intergenic
973134927 4:46695475-46695497 TGTCTCCCATCACCCCCAGATGG - Intergenic
973212438 4:47631489-47631511 TGTCTCCCATCACCCTCAGATGG + Intronic
973257485 4:48127947-48127969 TTTCTTCCAGTGCCCCCTGGTGG - Intronic
973650769 4:52995196-52995218 TGTCTCCCATCACTCCCAGATGG - Intronic
973990681 4:56403760-56403782 TGTCTCCCATCACCCCCAGATGG - Intronic
973992237 4:56421242-56421264 TGTCTCCCATCACTCCCAGATGG + Intronic
974091041 4:57311763-57311785 TGTCTCCCATCACCCTCAGATGG - Intergenic
974312042 4:60224955-60224977 TGTCTCCCATCACCCCCAGATGG - Intergenic
974401721 4:61416936-61416958 TATCTCCCATCACCTCCAGATGG - Intronic
974465265 4:62247488-62247510 GTTCTCCCATGTCCCTCAGGAGG - Intergenic
974553869 4:63418168-63418190 TGTCTCCCATCACTCCCAGATGG - Intergenic
974811149 4:66947636-66947658 TGTCTCTCATCACCCCCAGATGG + Intergenic
975249349 4:72160103-72160125 TGTCTTCCATCACCCCCAGATGG + Intergenic
975349800 4:73332367-73332389 TGTCTCCCATCACTCCCAGATGG + Intergenic
975441814 4:74419908-74419930 TGTCTCCCATCACCCCGAGATGG - Intergenic
975477908 4:74844150-74844172 TGTCCCCCATCACCCCCAGATGG + Intergenic
975625364 4:76340659-76340681 TGTCTCCCATCACCTCCAGATGG + Intronic
975882636 4:78928882-78928904 TGTCTCCCATCACCCCCAGAGGG - Intronic
975960771 4:79901742-79901764 TGTCTCCCACCACCCCCAGATGG - Intronic
976122712 4:81800490-81800512 TGTCTCCCATCACCTCCAGATGG - Intronic
976165285 4:82248020-82248042 TGTCTCCCATCACCACCAGATGG + Intergenic
976398973 4:84586390-84586412 TGTCTCCCATCACCCCCAGGTGG - Intronic
976555675 4:86448875-86448897 TGTCTCCTATCACCCCCAGATGG - Intronic
976672245 4:87666325-87666347 TGTCTCCCATCACCCCCAGATGG - Intergenic
976787233 4:88835627-88835649 TGTCTCCCATCTCCCCCAGATGG - Intronic
977263892 4:94831943-94831965 TGTCTCCCATCACTCCCAGGTGG + Intronic
977643705 4:99387093-99387115 TGTCTCCCATCACCCCTAGATGG + Intergenic
977685049 4:99837856-99837878 TGTCTCCCATCACCCCCAGATGG - Intronic
977699833 4:100008554-100008576 TGTCTCCCATCACCCCCAGATGG - Intergenic
978009265 4:103658950-103658972 TGTCTCCCATCAACCCCAGATGG - Intronic
978213608 4:106169807-106169829 TATCTCCCATTATCCCCAGATGG - Intronic
978315959 4:107437437-107437459 TGTCTCCCATCACCCCCAGATGG - Intergenic
978367971 4:108002414-108002436 TGTCTCCCATTATCCCCACATGG + Intronic
978471834 4:109076747-109076769 TGTTTCCCATCACCCCCAGATGG - Intronic
979258703 4:118630270-118630292 TTTCTCCCATCACGCTCAGGTGG + Intergenic
979329645 4:119410286-119410308 TTTCTCCCATCACGCTCAGGTGG - Intergenic
979350331 4:119636882-119636904 TGTCTCCCATCACCCCCACATGG - Intergenic
979445824 4:120809951-120809973 TGTCTCCCATCACCCCCAGATGG + Intronic
979478260 4:121183806-121183828 TGTTTCCCATCACCCCCAGATGG + Intronic
979685138 4:123503734-123503756 TGTCTCCCATCACTCCCAGATGG - Intergenic
979801016 4:124908911-124908933 TGTCTCCCATCACCCCCAGATGG - Intergenic
979971369 4:127139904-127139926 TATCTCCCATCACCCCGAGATGG - Intergenic
980016647 4:127657732-127657754 TGTCTCCCATCACCCCCAGATGG + Intronic
980061287 4:128132911-128132933 TGTCTCCCATCACCCCCAGATGG - Intronic
980206996 4:129732867-129732889 TGTCTCCCATCACTCCCAGATGG - Intergenic
980250894 4:130313222-130313244 TGTTTCCCATCACCCCCAGCTGG + Intergenic
981492401 4:145353489-145353511 TGTCTCCCATCACCCGCAGATGG + Intergenic
981691078 4:147509755-147509777 TGTCTCCCATTAACCCTAGATGG + Intronic
981980080 4:150781291-150781313 TGTCTCCCATCACCCCCAGATGG - Intronic
981990367 4:150912425-150912447 TGTCTCCCATCACCCCCGGATGG + Intronic
982023918 4:151233146-151233168 TGTCTCCCATCACCCCCAGATGG + Intronic
982073111 4:151713144-151713166 TGTCTCCCATCACCCCCAGATGG + Intronic
982078821 4:151766756-151766778 CATCTCCCATCACCCCCAGATGG - Intergenic
982086279 4:151840017-151840039 TGTCTCCCATCACCCCCAGATGG + Intergenic
982104277 4:151998052-151998074 TGTCTCCCATCACGCCCAGATGG + Intergenic
982713713 4:158784585-158784607 TATCTCCCATCAACCCCAGATGG - Intronic
982867949 4:160541456-160541478 TGTCTTCCATCACCCCCAGATGG - Intergenic
982924564 4:161319794-161319816 TGTCTCCCATCACCCCCAGATGG + Intergenic
983016605 4:162621270-162621292 TGTCTCCTATCGCCCCCAGGTGG + Intergenic
983157607 4:164370310-164370332 TTTCTTCCCTTTCCCCCAGCAGG - Intronic
983433462 4:167681175-167681197 TGTCTCCCATTACCTCCAGATGG - Intergenic
983439756 4:167766314-167766336 TGTCTCCTATCACCCCCAGATGG - Intergenic
983578769 4:169286853-169286875 TATCTCCCATCACCCACAGATGG - Intergenic
983679980 4:170342211-170342233 TATCTCCCATCACCCACAGATGG + Intergenic
983850225 4:172570845-172570867 TGTCTCCCATCACCCCCAGATGG - Intronic
983874435 4:172859885-172859907 TATCTCCCATCACCCCCAGATGG + Intronic
984173498 4:176388643-176388665 TGTCTCCCATCACCCCCAGATGG + Intergenic
984311637 4:178068142-178068164 TGTCTCCCATCACCCCCAGGTGG - Intergenic
984480244 4:180291580-180291602 TGTCTCTCATCACCCCCAGATGG + Intergenic
984823370 4:183904018-183904040 TGTCTCCCATCACCTCCAGATGG - Intronic
985080534 4:186260080-186260102 TGTCTCCCATCACCCTCAGATGG - Intergenic
985887293 5:2689455-2689477 TGTCTCCCATCACCCCCAGATGG + Intergenic
986216430 5:5723808-5723830 TGTCTCCCATCACCCCCAGGAGG - Intergenic
986373454 5:7105398-7105420 TGCCTCCCATCACCCCCAGAGGG - Intergenic
986835052 5:11627831-11627853 TGTCTCCCATCACCCCCAGATGG - Intronic
986952089 5:13101153-13101175 TGTCTCCCATCACCCCCAAATGG + Intergenic
987012885 5:13785147-13785169 TGTCTCCCATCACCCTCAGATGG - Intronic
987017879 5:13838567-13838589 TGTCTCCCATCACCCCCAGATGG + Intronic
987035270 5:14012982-14013004 TGTCTCCCATCACCCCCAGATGG - Intergenic
987528578 5:19084657-19084679 TGTCTCCCATCACTCCCAGTTGG + Intergenic
987836364 5:23168428-23168450 TGTCTCCCATCACCCCCAGCTGG + Intergenic
988540698 5:32106177-32106199 TGTCTCCCATCACCCCCAGATGG - Intronic
988589507 5:32536619-32536641 TGTCTCCCATCATCCCCAGATGG + Intronic
988781621 5:34527738-34527760 TTTCTCCAGCTACTCCCAGGTGG - Intergenic
988808140 5:34759586-34759608 TGTCTCCCATCACCCCCAGTTGG + Intronic
989153339 5:38321165-38321187 TTTCTCCCATCACCCCCAGATGG - Intronic
989512415 5:42303636-42303658 TCTCTCCCAGCACCCCCAGATGG + Intergenic
989552367 5:42750848-42750870 TGTCTCCTATTACCCCCAGATGG + Intergenic
990009665 5:50981795-50981817 TATCTCCCATCACCCCCATCTGG + Intergenic
990117723 5:52409823-52409845 TATCTCCCATCACCCCCAGATGG - Intergenic
990520081 5:56571262-56571284 TGTCTCCCATTGCCCCCGGATGG + Intronic
990612131 5:57468295-57468317 TGACTCCCATCACCCCCAGATGG - Intergenic
990890716 5:60646915-60646937 TGTCTCCCATCATCCCCAGATGG + Intronic
991003900 5:61809373-61809395 TATCTCCCATCTCCCCCAGCTGG - Intergenic
991187326 5:63825336-63825358 TGTTTCCCATCACCCCCAGATGG - Intergenic
991316167 5:65309283-65309305 TGTCTCCCATCACCCCTAGATGG - Intronic
991575523 5:68099381-68099403 TGTCTCCCATCACCCCCAGATGG - Intergenic
991670094 5:69038573-69038595 TGTCTCCCATCACACCCAGATGG - Intergenic
991719425 5:69481521-69481543 TTTCTCCCATCACCCCCATTTGG - Intergenic
992062558 5:73069445-73069467 TGTCTCCCATCACCCCCAGATGG - Intronic
992317323 5:75569928-75569950 TGTCTCCCATCACCCCCAGATGG + Intronic
992428860 5:76687758-76687780 TGTCTCCCATCACCCACAGATGG + Intronic
992664095 5:78989062-78989084 TGTCTCCCATCACCCTCAGATGG - Intergenic
993011892 5:82492494-82492516 TGCCTCCCATCACCCCCAGATGG + Intergenic
993078793 5:83270030-83270052 TGTCTCCCATCACCCCCAAATGG - Intronic
993855237 5:93066201-93066223 TATCTCCCATTACCCCCACATGG + Intergenic
994323615 5:98422953-98422975 TGTCTTCCATCACCCCCAGAAGG - Intergenic
994643514 5:102440439-102440461 TATCTCCCATCACCCCTAGATGG + Intronic
994669027 5:102744273-102744295 TGTCTCCCATCACCCCCAGATGG + Intergenic
994671461 5:102766332-102766354 TGTCTCCCATCACCCCCAGATGG - Intronic
995104110 5:108353746-108353768 TTTTTCCCCTTACCCTTAGGTGG - Intronic
995548057 5:113252489-113252511 TGTCTGCCATCACCCCCAGATGG + Intronic
995709584 5:115021323-115021345 TGTCTCCCATCACCCCCAGATGG - Intergenic
995860544 5:116636011-116636033 TGTCTCCCATCAGCCCCAGATGG + Intergenic
995861350 5:116644129-116644151 TGTCTCCCATCACCCCCAGATGG - Intergenic
995911790 5:117196468-117196490 TGTCTCCCATCACCCCCAGATGG - Intergenic
995922847 5:117334277-117334299 TGTCTCCCATCGCCCCCAGATGG - Intergenic
996080259 5:119251278-119251300 TGTCTCCCATCACCCCCAGATGG + Intergenic
996309662 5:122090812-122090834 TGTCTCCCATCACCCCCAGATGG - Intergenic
996567733 5:124897737-124897759 TGTCTCCCATCACCCCCAGATGG + Intergenic
996583198 5:125054515-125054537 TGTCTCCCATTACCCCCAGGTGG + Intergenic
996585155 5:125079377-125079399 TGTCTCCCATCACCCCCAGATGG + Intergenic
996626884 5:125580690-125580712 TATCTCCCATCAACCCCAGATGG + Intergenic
996760943 5:126985059-126985081 TTTCTCCCACCACCACCTGGGGG - Intronic
996861616 5:128073386-128073408 TGTCTCCCAACACCCCCAGCTGG - Intergenic
996869267 5:128168642-128168664 TGTCTCCCATCACCCCCAGACGG - Intronic
997068004 5:130584663-130584685 TCTCTCCCATTACCCAGTGGAGG - Intergenic
997236703 5:132276231-132276253 TGTCTCCCATCACCCCCAGATGG + Intronic
997811499 5:136974781-136974803 TGTCTTCCATCACCCCCAGATGG - Intergenic
997900368 5:137757922-137757944 TGTCTCCCATCACCCCCAGATGG - Intergenic
998069901 5:139189421-139189443 TGTCTCCCATCACCCCCAGATGG + Intronic
998481611 5:142467755-142467777 TGTCTCCCATCACCCCCAGGTGG + Intergenic
998606309 5:143638681-143638703 CTCCTCCCATCACCCCCAGATGG - Intergenic
998765539 5:145482775-145482797 TGTCTCCCATCACCCCCAGATGG - Intronic
998926685 5:147134457-147134479 TGTCTCCTATCACCCCCAGATGG - Intergenic
998929511 5:147165460-147165482 TGTCTCCCATTACCCCCAGATGG - Intergenic
999165068 5:149542254-149542276 TGTCTCCCATGACCCCCAGATGG + Intronic
999193762 5:149768010-149768032 TATCTCCCATCACCCCCAGATGG - Intronic
999428918 5:151509625-151509647 TGTCTCCCATCACCTCCAGATGG + Intronic
999534864 5:152505092-152505114 TCTCTCCCATGACCACCAGTTGG - Intergenic
999559270 5:152782600-152782622 TGTCTCCCATCACCCCCATATGG - Intergenic
999587257 5:153103668-153103690 TGTCTCTCATCACCTCCAGGTGG + Intergenic
999588202 5:153114837-153114859 TGTCTCCCATCACCCCCAGATGG - Intergenic
999761838 5:154707744-154707766 TATCTCCCATCACCCCCAAATGG - Intergenic
1000362552 5:160461412-160461434 TGTCTTCCATCACCCCCAGATGG - Intergenic
1000603946 5:163308055-163308077 CATCTCCCATCACCCCCAGATGG - Intergenic
1000706919 5:164523928-164523950 TATCTCCCATCACCCTCAGATGG + Intergenic
1000814119 5:165899311-165899333 TGTCTCCCATCATCCCCAGATGG + Intergenic
1000857081 5:166412299-166412321 TGTCTCCCATCATCCCCAGATGG - Intergenic
1001010633 5:168094662-168094684 TGTCCCCCATGACCCCCAGATGG - Intronic
1001010665 5:168095001-168095023 TGTCTCCCATCACCCCTAGATGG + Intronic
1001910806 5:175515913-175515935 TGTCTCCCATCACCCCCAGACGG - Intronic
1002650678 5:180690870-180690892 TGTCTCCCATCACCCCCAGATGG + Intergenic
1002728885 5:181320476-181320498 TTTCTCCCATCACGCTCAGGTGG + Intergenic
1002729284 5:181323883-181323905 TTTCTCCCATCACGCTCAGGTGG + Intergenic
1002765077 6:232409-232431 TGTCTCCCATCACCCCCAGATGG - Intergenic
1002769529 6:278933-278955 TTTCTCCCATTTACCACTGGTGG + Intergenic
1002858383 6:1057878-1057900 ATGCTCCCATCATCCCCAGGAGG + Intergenic
1003342724 6:5237374-5237396 TGTCTCCCATCATCCCCAGAGGG + Intronic
1003486458 6:6584326-6584348 TGTCCCCCATCACCCCCAGATGG - Intergenic
1003712983 6:8614213-8614235 TGTCTCTCATCACCCCCAGATGG + Intergenic
1003829287 6:9988984-9989006 TTTCACCCATGACCCTCTGGGGG - Intronic
1003850761 6:10220236-10220258 TGTCTCCCGTCACCCCCAGATGG - Intergenic
1004030708 6:11866325-11866347 TGTCTCCCATCACTCCCAGATGG + Intergenic
1004121234 6:12824233-12824255 TGTCTCCCATCACCCCCAGATGG + Intronic
1004148457 6:13091698-13091720 TGTCTCCCATTACCACCAGATGG - Intronic
1004148576 6:13092676-13092698 TGTCTCCCATCACCGCCAGATGG - Intronic
1004177103 6:13349509-13349531 TGTCTCCCATCACCCCCAGATGG - Intergenic
1004327246 6:14686523-14686545 TGTCTCCCATCACCCCCACATGG - Intergenic
1004491247 6:16118499-16118521 TGTCTCTCATCACCCCCAGATGG - Intergenic
1004549716 6:16635219-16635241 TGTCTCCCATCACCCCTAGATGG + Intronic
1004632696 6:17437019-17437041 TGTCTCCCATCACCCCCAGATGG + Intronic
1004633037 6:17439616-17439638 TGTCTCCCATTACCCCTAAATGG - Intronic
1004770086 6:18771600-18771622 TGTCTCCCATCACCCCCAGAAGG + Intergenic
1004790796 6:19024069-19024091 TGTCTCCCATCACCCTCAGATGG + Intergenic
1004852300 6:19712643-19712665 TGTCTCCCATCACCTCCAGATGG + Intergenic
1004911803 6:20292925-20292947 TGTCTCCCATCACTCCCAGATGG - Intergenic
1004952247 6:20686473-20686495 TGTCTCCCATCACCCCCAGATGG + Intronic
1005094728 6:22102396-22102418 TCTCCCCCATTGCCCCCAAGGGG + Intergenic
1005932739 6:30495988-30496010 TGTCTCCCATCACCCTCAGATGG - Intergenic
1006507533 6:34499136-34499158 TGTCTCCCATCACCCCCAGATGG - Intronic
1006735894 6:36272212-36272234 TGTCTCCCATCACCCTCAGATGG - Intronic
1007066956 6:39000609-39000631 TGTCTTCCATCACCCCCAGATGG + Intronic
1007132667 6:39491040-39491062 TTTGTCCCATCACCATCAGGAGG + Intronic
1007343904 6:41213542-41213564 TGTCTCCCATCACCCCCAGATGG + Intergenic
1007344159 6:41215816-41215838 TATCTCCCATCACTCCCAGATGG - Intergenic
1007346221 6:41231058-41231080 TGTCTCCCATCACTCCCAGATGG + Intronic
1007420923 6:41719199-41719221 TGTCTCCCATCACCCCCAGATGG + Intronic
1008278044 6:49563740-49563762 TGTCTCCCATCACCCCCAGATGG + Intergenic
1008681641 6:53878442-53878464 TGTTTCCCATCACCCCCAGATGG - Intronic
1008820099 6:55621588-55621610 TGTCTCCCATCACCTCCAGATGG + Intergenic
1008897248 6:56570397-56570419 CATCTCCCATCACCCCCAGATGG - Intronic
1009052214 6:58289830-58289852 TGTCTCCCATTAACCCCAAATGG - Intergenic
1009319393 6:62267711-62267733 TCTCTCCTATTCCCCCCATGTGG + Intronic
1009365131 6:62852063-62852085 TTTTTCCTAATACCCACAGGGGG + Intergenic
1009370866 6:62900798-62900820 TTTCTCTCATTATTCCAAGGAGG - Intergenic
1009523581 6:64715251-64715273 TGTCTCCCATCACCCCCAGAAGG - Intronic
1009920954 6:70060654-70060676 TGTCTCCCATCACCCCTAGAAGG + Intronic
1009979980 6:70716280-70716302 TGTCTCCCATCACCCCCAGATGG - Intronic
1010120894 6:72374872-72374894 TCTCTCCCATCACCCCCAGATGG - Intronic
1010123352 6:72405344-72405366 TGTCTCCCATCACCCCTAGATGG + Intergenic
1011035851 6:82973964-82973986 TGTCTCCCATCACCCCCAGATGG + Intronic
1011781284 6:90792300-90792322 TTTTTCCCATTATCCTCAGCTGG - Intergenic
1011804940 6:91061155-91061177 TGTCTTCCATTATCCCCAGAAGG + Intergenic
1011894148 6:92202854-92202876 TATCTCCTATCACCCCCAGATGG + Intergenic
1012049548 6:94323907-94323929 TGTCTCCCATCACCCCCAGATGG - Intergenic
1012973416 6:105755158-105755180 TGTCTCCCATCACCCCCAGATGG + Intergenic
1013377258 6:109529673-109529695 TATCTCCCATCACCTCCAGATGG - Intronic
1013501025 6:110751437-110751459 TGTCTCCCATCACCCCCAGATGG + Intronic
1014010458 6:116469588-116469610 TGTCTCCCCTTACCCCCAGATGG - Intergenic
1014227313 6:118862491-118862513 TGTCTCCCATCATCCCCAGATGG - Intronic
1014335773 6:120134243-120134265 TGTCTCCCATCACACCCAGATGG - Intergenic
1014615248 6:123590352-123590374 TGTCTCCAATCGCCCCCAGGTGG + Intronic
1014650456 6:124030114-124030136 TGTCTCCCATCACCCCCATATGG + Intronic
1014747522 6:125217388-125217410 TGTCTCCCGTTTCCCCCAGATGG - Intronic
1015088862 6:129330061-129330083 TGTCTCCCATCACCCCAAGATGG + Intronic
1015147692 6:130005765-130005787 TGTCTCCCATCACCCCCAGATGG - Intergenic
1015166896 6:130208639-130208661 TGTCTTCCATCACCCCCAGATGG + Intronic
1016442479 6:144097928-144097950 TATCCCCCATCACCCCCAGATGG - Intergenic
1016785393 6:148005792-148005814 TGTCTCCCATCACCCCCAAATGG - Intergenic
1016841382 6:148528927-148528949 TGTCTCCCATCATCCCCAGATGG - Intronic
1016845001 6:148561092-148561114 TGCCTCCCATCACCCCCAGAAGG + Intergenic
1017097323 6:150816108-150816130 TGTCTCCCATCACCCCCAGATGG - Intronic
1017207528 6:151819597-151819619 TGTGTCCCATCACCCCCAGATGG + Intronic
1017223038 6:151988242-151988264 TGTCTCCCATCACCCCCAGATGG - Intronic
1017430844 6:154369349-154369371 TGTCTCCCATCACCCCCAGATGG + Intronic
1018050092 6:160001341-160001363 TGTCTCCCATCACCCCCAGATGG + Intronic
1018217103 6:161539050-161539072 TCTCTGCCCTTACCCCCAAGGGG + Intronic
1018329139 6:162709085-162709107 TGTCTCCCATCACCTCCAGATGG + Intronic
1018512520 6:164540732-164540754 TGTCTCCCATCACCCCCAAATGG + Intergenic
1018752000 6:166814785-166814807 TGTCTCCCATCACCCCCAGATGG + Intronic
1019392891 7:799403-799425 TGTCTCCCATCACCCACAGATGG + Intergenic
1019466404 7:1191911-1191933 TGTCTCCCATCACCCACAGATGG + Intergenic
1019866159 7:3712347-3712369 TGTCTCCCATCACCCCCAGATGG + Intronic
1019949648 7:4361114-4361136 TGTCTCCCATTATCCCCAGATGG - Intergenic
1019986298 7:4658723-4658745 GATCTCCCATCACCCCCAGATGG - Intergenic
1020184308 7:5947230-5947252 TGTCTCCCATCACCCCCAGATGG - Intronic
1020187675 7:5971276-5971298 TGTCTCCCGTCACCCCCAGATGG - Intergenic
1020211114 7:6158831-6158853 TGTCTCCCAGTAGCCCCAGCTGG - Intronic
1020295242 7:6753494-6753516 TGTCTCCCGTCACCCCCAGATGG + Intergenic
1020298609 7:6777536-6777558 TGTCTCCCATCACCCCCAGATGG + Intronic
1020385129 7:7592612-7592634 TGTCTCCCATCATCCCCAGATGG - Intronic
1020780244 7:12508875-12508897 TGTCTCCCATCACCCCCAGATGG + Intergenic
1020848341 7:13316099-13316121 TGTCTCCCATCACCCCCACATGG - Intergenic
1021284233 7:18759476-18759498 TGTCTCCTATCACCCCCAGAGGG + Intronic
1021347786 7:19548807-19548829 TGTCTCCCATCACTCCCAGATGG - Intergenic
1021448704 7:20760851-20760873 TGTCTCCCATCATCCCCAGATGG + Intronic
1021589443 7:22244536-22244558 TGTCTCCCATCACCCCCAGATGG + Intronic
1021885225 7:25131216-25131238 TATCTCCCATCACCCCCACATGG + Intergenic
1022222137 7:28323872-28323894 TGTCTCCCATCACTCCCAGATGG - Intronic
1022515387 7:30971944-30971966 TTTCTCCCATTACCCCCAGGAGG + Exonic
1022723594 7:32961842-32961864 TGTCTCCCATCACCCCTAGATGG + Intronic
1023113940 7:36841946-36841968 TCTCTCTGAATACCCCCAGGAGG - Intergenic
1023400678 7:39791575-39791597 TTTCTCCCATCACGCTCAGGTGG + Intergenic
1023408666 7:39864108-39864130 TGTCTCCCATCACCCCCAGAGGG + Intergenic
1023425854 7:40035592-40035614 TGTCTCCCATCATCCCCAGATGG + Intronic
1024127235 7:46311934-46311956 TGTCTCCCATCACCCCCAGATGG - Intergenic
1024322054 7:48080272-48080294 TATCTCCCATCACCCCCAGGTGG + Intergenic
1024351917 7:48375031-48375053 TGTCTCGCATCACCCCCAGGTGG + Intronic
1024415218 7:49097780-49097802 CTTCTCCCATTACAGCCTGGAGG + Intergenic
1024520175 7:50298753-50298775 TGTCTCCCATCACCCCCAGATGG - Intergenic
1024649726 7:51392878-51392900 TTTCTCCCATCACGCTCAGGTGG - Intergenic
1024818334 7:53296958-53296980 TGTCTCCCGTCACCCCCAGATGG + Intergenic
1025044287 7:55679901-55679923 TGTCTCCCATCACCCCCAGATGG - Intergenic
1025050036 7:55726075-55726097 TGTCTCCCATCACCCCTAGATGG - Intergenic
1025053805 7:55748209-55748231 TTTCTCCCATCACGCTCAGGTGG - Intergenic
1025108106 7:56190007-56190029 TGTCTCCCATCACCCCCAGATGG - Intergenic
1025131910 7:56378683-56378705 TTTCTCCCATCACGCTCAGGTGG - Intergenic
1025137210 7:56428438-56428460 TGTCTCCCATCACCCCCAGATGG - Intergenic
1025185878 7:56858035-56858057 TGTCTCACATCACCCCCAGATGG - Intergenic
1025686048 7:63718906-63718928 TGTCTCACATCACCCCCAGATGG + Intergenic
1025937667 7:66050080-66050102 TATCTCCCATCACCCCCAGATGG - Intergenic
1025980445 7:66400977-66400999 TGTCTCCCATCACCCCCAGATGG - Intronic
1026043077 7:66885170-66885192 TGTCTCCCATCACCCCCACATGG + Intergenic
1026112285 7:67468090-67468112 TGTCTCCCATCACCCCCAGATGG + Intergenic
1026149581 7:67776589-67776611 TGTCTCCCATCACCCCCAGATGG - Intergenic
1026181504 7:68045108-68045130 TGTCTCCCATCACCCTCAGATGG - Intergenic
1026189469 7:68111727-68111749 TGTCTCCCATCAGCCCCAGATGG - Intergenic
1026224081 7:68425554-68425576 TGTCTCCCATCACCCCCAGATGG + Intergenic
1026260615 7:68752213-68752235 TGTCTCCCATCACCTCCAAGTGG + Intergenic
1026270404 7:68831508-68831530 TGTCTCACATCACCCCCAGATGG - Intergenic
1026292113 7:69017212-69017234 TGTCTCCCATCACCCCCAGATGG - Intergenic
1026316006 7:69228213-69228235 TGTCTCCCATCACCCCCAGATGG - Intergenic
1026326322 7:69313877-69313899 TGTCTCCCATCACCCCCAGATGG - Intergenic
1026516019 7:71073038-71073060 TATCTTCCATCACCCCCAGGTGG - Intergenic
1026533279 7:71218819-71218841 CGTCTCCCATCACCCCCAGATGG + Intronic
1026550705 7:71365970-71365992 TGTCTCCCATCACCCCCAGATGG - Intronic
1026564097 7:71475378-71475400 TGTCTCCCATCACCCCCAGAAGG - Intronic
1026574713 7:71562480-71562502 CGTCTCCCATCACCCCCAGATGG - Intronic
1027173913 7:75891276-75891298 TGTCTCCCATCACCCCCAGATGG - Intergenic
1027205331 7:76093351-76093373 TATCTCCCATCACCCCCAGATGG - Intergenic
1027243773 7:76351713-76351735 TGTCTCCCATCACCCCCAGACGG + Intronic
1027482695 7:78718596-78718618 TGTCCCCCATCACCCCCAGATGG + Intronic
1027494737 7:78873519-78873541 TGTCTCCCATCACCCCCAGATGG + Intronic
1028297128 7:89147826-89147848 TGTCTCCCATCACCCCCAGATGG + Intronic
1028479794 7:91292286-91292308 TGTCTCCCATCACTCCCAGGTGG + Intergenic
1028563695 7:92204558-92204580 TGCCTCCCATCACCCCCAGATGG - Intronic
1028917347 7:96274016-96274038 TTTCTACCCTAACCCCAAGGGGG - Intronic
1029156935 7:98523997-98524019 TGTCTCCCATCACCCCCAGACGG - Intergenic
1029180058 7:98693929-98693951 TGTCTCCCATCACCCCTAGATGG + Intergenic
1029232075 7:99078757-99078779 TGTCTCCCATCACCCCCACATGG + Intronic
1029241702 7:99167816-99167838 TATCTCCCATCACCTCCAGATGG + Intergenic
1029242539 7:99174278-99174300 TGTCTCCCATCACCCCCAGATGG + Intronic
1029347696 7:99990730-99990752 TGTCTCCCATCAACCCCAGATGG + Intergenic
1029431766 7:100535755-100535777 TGTCTCCCATCACCCCCAGATGG - Intergenic
1029491014 7:100870039-100870061 TGTCTCCCATCACCCCCAGATGG - Intronic
1029571779 7:101374635-101374657 TGTCTCCCATCACCCCCAGATGG + Intronic
1029683199 7:102126902-102126924 TGTCTCCCATCACCCCCAGATGG - Intronic
1030478275 7:110066985-110067007 TTTCTCACATTACACCCACTGGG + Intergenic
1030545453 7:110889357-110889379 TATCTCCCATCACCCCCAGAGGG - Intronic
1030661251 7:112221615-112221637 TGTCTCCCATCACCCCCAGATGG - Intronic
1031228600 7:119074814-119074836 TGTCTCCCATCACCCCCAGAAGG + Intergenic
1031786985 7:126045520-126045542 TGTCTCCCATCACCCCCAGATGG + Intergenic
1031826765 7:126575303-126575325 TGTCTCCCATCACCCCCAGATGG + Intronic
1032051006 7:128651019-128651041 TTTCTCCCATCACGCTCAGGTGG + Intergenic
1032116107 7:129118548-129118570 TGTCTCCCATCACCCCCAGATGG + Intergenic
1032707282 7:134432368-134432390 TGTCTCCCATCACTCCCAGATGG - Intergenic
1032903325 7:136335960-136335982 TGTCTCCCATCACCCCCAGGTGG + Intergenic
1032950633 7:136906962-136906984 TGTCTCCCATCACCCCCAGATGG - Intronic
1033684814 7:143628687-143628709 TGTCTCCCATCACCTTCAGGTGG + Intronic
1033687989 7:143707906-143707928 TGTCTCCCATCACCTTCAGGTGG + Intronic
1033699799 7:143828934-143828956 TGTCTCCCATCACCTTCAGGTGG - Intergenic
1034316606 7:150138952-150138974 TGTCTCCCATCATCCCCAGATGG + Intergenic
1034370018 7:150586855-150586877 TTTATCCCTCTACACCCAGGAGG + Intergenic
1034635131 7:152561175-152561197 TGTCTCCCATCACCCCCAGATGG + Intergenic
1035286152 7:157808541-157808563 TGTCTCCCATCACCCCCAGATGG + Intronic
1035986037 8:4433096-4433118 TGTCTCCCATCACCTCCAGATGG + Intronic
1036038183 8:5043038-5043060 TGTCCCCCATCACCCCCAGAAGG - Intergenic
1036115998 8:5961475-5961497 TGTCTCCCATCACCCCCAGATGG - Intergenic
1036621944 8:10429988-10430010 TGTCTCCCATTGCCCCCAGATGG - Intergenic
1036772082 8:11586218-11586240 TGTCTCCCATCACCCCCAGATGG + Intergenic
1036917035 8:12814179-12814201 TTTATTTCGTTACCCCCAGGAGG - Intergenic
1037190382 8:16117754-16117776 TGTCTCCCATCAGCCCCAGATGG + Intronic
1037241875 8:16786516-16786538 TGCCTCCCATCACCCCCAGATGG + Intergenic
1037463615 8:19137772-19137794 TGTCTCCCATCACCCCCAGATGG + Intergenic
1037485900 8:19346448-19346470 TGCCTCCCATTACCCTCAGATGG + Intronic
1037560628 8:20071473-20071495 TGTCTCCCATCATCCCCAGAAGG + Intergenic
1037742510 8:21618789-21618811 TGTCTCCCATCACCCACAGATGG + Intergenic
1037845556 8:22278899-22278921 TGTCTCCCATCACCCACAGATGG + Intronic
1038166794 8:25093340-25093362 TGTCTCCCATCACCCCCAGATGG + Intergenic
1038199082 8:25395103-25395125 TGTCTCCCATTACCTCTAGAAGG - Intronic
1038285262 8:26200733-26200755 TGTCTCCCATCACCCCCAGATGG + Intergenic
1038362418 8:26894205-26894227 TGTCTCCCATCACCCCCAGATGG + Intergenic
1038507362 8:28096159-28096181 TGTCTCCCATCACCCCCAGATGG + Intronic
1038681294 8:29670812-29670834 TTTCTCCCATCACCCCCAGATGG + Intergenic
1038687222 8:29729479-29729501 TGTCTCCCATCACCCCCAGAGGG - Intergenic
1038724475 8:30068382-30068404 TGTGTCCCATCACCCCCAGATGG + Intronic
1038745875 8:30254249-30254271 TGTCTCCCATCATCCCCAGATGG - Intergenic
1038796837 8:30717666-30717688 TGTCTCCCATCAGCCCCAGATGG + Intronic
1038841549 8:31188982-31189004 TGTGTCCCATCACCCCCAGATGG - Intergenic
1038863613 8:31414663-31414685 TGTCTCCCATCACACCCAGATGG - Intergenic
1038901437 8:31848764-31848786 TGTCTCCCATCACCCCCAGATGG + Intronic
1039013921 8:33125176-33125198 TGTCTCCCACCACCCCCAGATGG + Intergenic
1039042018 8:33417223-33417245 TGTCTCCCATCACCCCCAGATGG + Intronic
1039748455 8:40454618-40454640 TGTCTCCCATCACCCCCAGATGG + Intergenic
1039956489 8:42210917-42210939 TGTCTCCCATAACCCCCAGATGG + Intergenic
1039958339 8:42224285-42224307 TGTCTCCCATCACCCCCAGATGG + Intergenic
1040010668 8:42658655-42658677 TGTTTCCCATCACCCCCAGATGG - Intergenic
1040082731 8:43305038-43305060 TGTCTCCCTTTGCCCCCAGATGG - Intergenic
1040408222 8:47130024-47130046 TGTCTCCCTTTGCCCCCAGATGG + Intergenic
1040729477 8:50425446-50425468 TGTCTCTCATCACCCCCAGATGG + Intronic
1040808446 8:51422135-51422157 TGTCTCCCATCACCCCCAGATGG + Intronic
1040858895 8:51978808-51978830 TGTCTCCCATCACCCCCAGATGG - Intergenic
1040907473 8:52483472-52483494 TGTCTCCCATCACCCCCAGATGG - Intergenic
1041015156 8:53585629-53585651 CTTCTTCCATTACCCACTGGTGG - Intergenic
1041373458 8:57189136-57189158 TATCTCCCATCACCCCCAGATGG + Intergenic
1041433431 8:57810076-57810098 TTTCTCTTATTAAACCCAGGAGG + Intergenic
1041646553 8:60258693-60258715 TGTCTCCCATCACCCCTAGATGG - Intronic
1041712609 8:60907945-60907967 TGTCTCCCATCACCCCCAGATGG + Intergenic
1042068722 8:64906974-64906996 TGTCTCCCATCACCTCCAGGTGG - Intergenic
1042315729 8:67424123-67424145 TGTCTCCCATCACCCCTAGATGG + Intronic
1042318622 8:67451417-67451439 TGTCTCCCATCACCCCTAGATGG + Intronic
1042406211 8:68408234-68408256 TGTCTCCCATCACCCCCAGATGG + Intronic
1042568029 8:70132438-70132460 GTTCTCTCATTTCTCCCAGGTGG - Intronic
1043097973 8:75999734-75999756 TGTCTCCCATCACCCGCAGATGG - Intergenic
1043332616 8:79136509-79136531 TTTCTTGTATTTCCCCCAGGTGG + Intergenic
1043935807 8:86140944-86140966 TGTCTCCCATCACCCACAGATGG - Intronic
1043979135 8:86618013-86618035 TGTCTCCCATCACCCCCAGATGG - Intronic
1044067170 8:87713072-87713094 TGTCTCTCATCACCCCCAGATGG + Intergenic
1044246816 8:89958019-89958041 TGTCTCCCATCACCCTCAGATGG - Intronic
1044416439 8:91945362-91945384 TGTCTCCCATCACCCCTAGATGG - Intergenic
1044503399 8:92989571-92989593 TGTCTCCCATCACCCCCAGATGG + Intronic
1045301535 8:100914986-100915008 TGTCTCCCATCACCTCCAGATGG - Intergenic
1045505730 8:102777059-102777081 TTCCTCCCCTGCCCCCCAGGTGG - Intergenic
1045601467 8:103722430-103722452 TGTCTCCCATCAACCCCAGATGG - Intronic
1045676584 8:104614532-104614554 TGTCTCCCATCATCCCCAGAAGG - Intronic
1046238131 8:111454160-111454182 TGTCTCCCATCACCCCTAGATGG + Intergenic
1046349313 8:112985799-112985821 TGTCTACCATCACCCCCAGATGG + Intronic
1046384348 8:113489552-113489574 TTTCTCTCTTTACTCCAAGGAGG + Intergenic
1046526693 8:115389859-115389881 TGTCTCCCATCACCCCTAGATGG - Intergenic
1046858615 8:119065419-119065441 TGTCTCCCATCATCCCCAGATGG + Intronic
1047175169 8:122534016-122534038 TGTCTCCCATCACCCCCAGATGG + Intergenic
1047430991 8:124791550-124791572 TCTCTCCCATCATCCCCAGATGG + Intergenic
1048044803 8:130763492-130763514 TGTCTCCCATCACCCCCAGATGG - Intergenic
1048071815 8:131029215-131029237 TGTCTCCCATCATCCCCAGATGG + Intronic
1048258447 8:132924126-132924148 TGTCTCCCATCACCCCCAAATGG - Intronic
1048290116 8:133174835-133174857 TGACTCCCATAACCCCCAGAGGG + Intergenic
1048429950 8:134360930-134360952 TGTCTCCCATCACCCCCAGATGG - Intergenic
1048456750 8:134585248-134585270 TATCTCGCATTACCCTCAGCAGG + Intronic
1048724192 8:137363084-137363106 TGTCTCCCATTACCCCCAAATGG - Intergenic
1048780741 8:137997299-137997321 TTTCTCCCATCACTCCCAGATGG + Intergenic
1048802124 8:138203855-138203877 TGTCTCCCATCACCCCCAGATGG - Intronic
1048938104 8:139373758-139373780 TCTCTCCCATCACCCCCAGATGG + Intergenic
1049000023 8:139819230-139819252 TGTCTCCCATCATCCCCAGATGG + Intronic
1049329296 8:142041639-142041661 TGTCTCCCATCACCTCCAGATGG - Intergenic
1050057085 9:1667098-1667120 TGTCTTCCATTGCCCCCAGATGG + Intergenic
1050164178 9:2747057-2747079 TGTCTCCCATCACCTCCAGATGG + Intronic
1050393931 9:5175794-5175816 TGTCTCCCATCACCCCCAGATGG + Intronic
1050412765 9:5383614-5383636 TATCTCCCATCACCCCTAGATGG - Intronic
1051332094 9:16033507-16033529 TGTCTCCCATCACCCCCAGATGG + Intronic
1051717373 9:19999113-19999135 ATTCTCCCAATAGCCCCAGTGGG - Intergenic
1051849929 9:21494559-21494581 TGTCTCCCATCACCTCCAGATGG - Intergenic
1052565547 9:30145350-30145372 TGTCTCCCATCACCCTCAGGTGG + Intergenic
1052613798 9:30812163-30812185 TATCTCCCATTACCCCCAGATGG + Intergenic
1052668820 9:31528982-31529004 TGTCTCCCATCACCCCCAGATGG - Intergenic
1052699487 9:31920763-31920785 TGTCTCCCATCATCCCCAGATGG + Intergenic
1054978595 9:71177181-71177203 TGTCTCCCAAAACCCCCAGATGG + Intronic
1054981351 9:71210257-71210279 TGTCTCCCATCACCCCCGGATGG + Intronic
1055045380 9:71918748-71918770 TGTCTCCCATCACCCCCAGATGG + Intronic
1055127041 9:72730775-72730797 TGTGTCCCATCACCCCCAGATGG - Intronic
1055307445 9:74944333-74944355 TGTCTCCCATCACCCCTAGATGG + Intergenic
1055316298 9:75037759-75037781 TGTCTCCCATCACCCCCAGATGG + Intergenic
1055416598 9:76090876-76090898 TGTCTCCTATCACCCCCAGATGG - Intronic
1055687667 9:78794684-78794706 TGTCTCCCATCACCTCCAGATGG - Intergenic
1055909349 9:81329554-81329576 TGTCTCCCATCACCCCCAGATGG + Intergenic
1056512660 9:87320517-87320539 TGTCTCCCATCACCCCCAGATGG - Intergenic
1056674667 9:88665156-88665178 TGGCTCCCATAACCCCCAGATGG + Intergenic
1057108795 9:92447326-92447348 TGTCTCCCATCACCCCCAGGTGG - Intronic
1057380261 9:94561010-94561032 TGTCCCTCATTACCCACAGGAGG + Intronic
1057775839 9:98008712-98008734 TGTCTCTCATTGCCCCCAGATGG + Intronic
1057974012 9:99584375-99584397 TGTCTCCCATCACCCTCAGATGG - Intergenic
1058000100 9:99856249-99856271 TGTCTCCCATCACCCCCAGATGG - Intronic
1058287152 9:103192368-103192390 TGTCTCCCATCACCCTCAGGTGG + Intergenic
1058615117 9:106818047-106818069 TATCTTCCATCACCCCCAGATGG - Intergenic
1058779296 9:108317344-108317366 TGTCTCCCATTACCCCCACATGG + Intergenic
1059018943 9:110552579-110552601 TGTCTCCCATCACTCCCAGATGG - Intronic
1059113391 9:111578416-111578438 TGTCTCCCATCACCCCCAGATGG - Intronic
1059151707 9:111955048-111955070 TCTTTCCCATCACCCCCAGATGG - Intergenic
1059764429 9:117370408-117370430 TTTCTCCCAGTACCACCCTGAGG - Intronic
1059996218 9:119912919-119912941 TGTCTGCCATAACCCCCAGATGG - Intergenic
1061581210 9:131537625-131537647 TGTCTCTCATCACCCCCAGATGG - Intergenic
1062075386 9:134585856-134585878 TTTCTAGCATTACCTCAAGGAGG + Intergenic
1062248483 9:135582578-135582600 TGTCTCCCATCACCCCCAGATGG - Intergenic
1062526832 9:136981319-136981341 ATTCACCCACCACCCCCAGGAGG + Intronic
1062753945 9:138277575-138277597 TTTCTCCCATCACGCTCAGGTGG + Intergenic
1203425361 Un_GL000195v1:32221-32243 CATCTCCCAGTACGCCCAGGAGG + Intergenic
1203576464 Un_KI270745v1:12354-12376 TTTCTCCCATCACGCTCAGGTGG + Intergenic
1203576861 Un_KI270745v1:15763-15785 TTTCTCCCATCACGCTCAGGTGG + Intergenic
1203577263 Un_KI270745v1:19185-19207 TTTCTCCCATCACGCTCAGGTGG + Intergenic
1185521961 X:747111-747133 TGTCTCCCATCACCCCCACAGGG - Intergenic
1185708757 X:2285294-2285316 TGTCTCCCATCACCCCCAGATGG - Intronic
1185720698 X:2379050-2379072 TGTCTCCCATTACCCCTAGATGG + Intronic
1185742399 X:2544394-2544416 TGTCTCCCATCAACCCCAGATGG + Intergenic
1185800470 X:3006061-3006083 TGTCTTCCATCACCCCCAGATGG - Intergenic
1185811138 X:3111792-3111814 TGTCTCCCATCACCCCCAGATGG - Intronic
1185836943 X:3353413-3353435 TCTCTCCCATCACCCCCAGATGG - Intergenic
1185837290 X:3356838-3356860 TGTCTCCCATCACCCCCAGATGG - Intergenic
1185837467 X:3358507-3358529 TGTCTCCCATCACCCCCAGATGG + Intergenic
1185851253 X:3490812-3490834 TGTCTCCCATCACCCCCAGATGG + Intergenic
1185928468 X:4173316-4173338 TGTCTCCCATCACCCCCAGGTGG + Intergenic
1185929414 X:4185666-4185688 TGTCTCCCATCGCCCCCAGATGG - Intergenic
1185985362 X:4826708-4826730 TGTGTCCCATCACCCCCAGACGG - Intergenic
1185985594 X:4828806-4828828 TGTCTCCCATCACCCCTAGATGG - Intergenic
1185986286 X:4838096-4838118 CATCTCCCATCACCCCCAGATGG + Intergenic
1186006735 X:5080443-5080465 TGTCTCTCATCACCCCCAGATGG - Intergenic
1186050237 X:5584639-5584661 TGTCTCCCATAACCCCCAGATGG - Intergenic
1186146300 X:6627607-6627629 TGTCTCCCATCAACCCCAGATGG + Intergenic
1186154060 X:6707506-6707528 TTTCTCCCATCACCCCCAGATGG - Intergenic
1186203764 X:7180266-7180288 TGTCTCCCATCACCCCCCGATGG - Intergenic
1186204812 X:7190206-7190228 TGTCTCCCATCACCTCCAGATGG - Intergenic
1186221696 X:7355993-7356015 TGTCTCCTGTTACCCCCAGATGG + Intergenic
1186336564 X:8596031-8596053 TGTCTCCCATCACCCCCAGATGG + Intronic
1186341980 X:8655229-8655251 TGTCTCCCATCACCCCCAGATGG - Intronic
1186497468 X:10023187-10023209 CTTCTCACAATACCCCCAGAGGG + Intronic
1186647713 X:11524858-11524880 TGTCTCCCATCATCCCCAGATGG - Intronic
1187014175 X:15309382-15309404 TGTCTCCCATCACCCCTAGATGG + Intronic
1187684283 X:21800939-21800961 TTTCTCCCTGTATCCACAGGAGG + Intergenic
1187693252 X:21893142-21893164 TGTCTCCCATCACCCCTAGACGG - Intergenic
1188065684 X:25656575-25656597 TGTCTCCCATCACCCCTAGATGG - Intergenic
1189114898 X:38332162-38332184 TGTTTCCCATCACCCCCAGATGG + Intronic
1189724896 X:43958582-43958604 TATCTCCCATTATCACCAGCAGG + Exonic
1189960247 X:46317641-46317663 TTCCTCCCATGACCCACAGTAGG + Intergenic
1190037631 X:47040482-47040504 CGTCTCCCATCACCCCCAGATGG + Intronic
1190068725 X:47261656-47261678 TGTCTCCCATCAGCCCCAGATGG - Intergenic
1190134172 X:47779851-47779873 TGTCTCCCATCACCCCCAGATGG - Intergenic
1190421380 X:50288034-50288056 TGTCTCCCATTTCCCCCAGATGG + Intronic
1190616618 X:52240291-52240313 TATCTCCCATCACCCCCAGAAGG - Intergenic
1190723562 X:53171539-53171561 TTTCCCCAACTACCACCAGGAGG - Intergenic
1191152463 X:57234571-57234593 TGTCTCCCATTACCCCAAGATGG - Intergenic
1192221952 X:69203416-69203438 TTTCTCCCTTTACTCCCGAGAGG + Intergenic
1192295380 X:69842280-69842302 TGTCTCCCATCACCCCCATATGG + Intronic
1193266460 X:79476931-79476953 CTTCTCCCATTTCCCCCAACAGG + Intergenic
1193278522 X:79620669-79620691 TGTCTCCCATCACCCCCAGGTGG + Intergenic
1194561857 X:95431336-95431358 TGTCTCCCATCCCCCCCAGATGG - Intergenic
1195465806 X:105177309-105177331 TGTCTCCTATCACCCCCAGATGG + Intronic
1195485232 X:105397107-105397129 TGTCTCCCATCACCCCCAGATGG + Intronic
1195922356 X:109996155-109996177 TGTCTCCCATCACCTCCAGATGG - Intergenic
1196488553 X:116243051-116243073 TGTCTTCCATCACCCCCAGATGG - Intergenic
1197005670 X:121493865-121493887 TTTCTCCCATTACCACTTGTTGG + Intergenic
1197458567 X:126709271-126709293 TGCCTCCCATCACCCCCAGATGG - Intergenic
1197709959 X:129658783-129658805 TGTCTCTCATCACCCCCAGATGG + Intergenic
1197729598 X:129798404-129798426 TTTCTCTCATGACCCCCAAGAGG - Intergenic
1197932401 X:131709553-131709575 TGTCTCTCATGACCCCCAGATGG - Intergenic
1198035800 X:132800318-132800340 TGTCTCCCATCACCTCCAGATGG + Intronic
1198377404 X:136053302-136053324 TGTCTCCCATCACCCCCAGATGG - Intergenic
1198395550 X:136215457-136215479 TGTCTCCCATCACCCCCAGATGG + Intronic
1198558659 X:137824594-137824616 TGTCTCCCATCACCCCCAGATGG - Intergenic
1199200035 X:145076336-145076358 TGTCTCCCATCACCCCCAGATGG - Intergenic
1199605821 X:149579009-149579031 TGTCTCCCATCACCCCCAGATGG + Intergenic
1199633300 X:149790359-149790381 TGTCTCCCATCACCCCCAGATGG - Intergenic
1199835535 X:151586489-151586511 TTACTCCCATTTCCCACATGAGG - Intronic
1200811483 Y:7490058-7490080 TGTCTCCCATCAGCCCCAGATGG - Intergenic
1200816546 Y:7539209-7539231 TGTCTCCCATAACCCCCAGATGG - Intergenic
1201238882 Y:11938736-11938758 TGTCTCCCATCACCTCCAGATGG + Intergenic
1201239628 Y:11946323-11946345 TCTCTCCCATCACCCCCAGATGG + Intergenic
1201576623 Y:15468144-15468166 GGTCTCCCATCACCCCCAGATGG - Intergenic
1201589839 Y:15603064-15603086 TGTCTCCTATCACCCCCAGATGG + Intergenic
1201677876 Y:16607944-16607966 TGTCTCCTATCACCCCCAGATGG - Intergenic
1201693176 Y:16792301-16792323 TGTCTTCCATCACCCCCAGATGG + Intergenic
1201693362 Y:16794399-16794421 TGTCTCCTATCACCCCCAGATGG + Intergenic
1201735958 Y:17261904-17261926 ATTCTCTCATTACCCCTAGATGG - Intergenic