ID: 1022515432

View in Genome Browser
Species Human (GRCh38)
Location 7:30972153-30972175
Sequence GACCCAGATGTGCCTGCGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022515423_1022515432 27 Left 1022515423 7:30972103-30972125 CCATGGGTGAAGGGGCTGGGCAG 0: 1
1: 0
2: 1
3: 52
4: 459
Right 1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG 0: 1
1: 0
2: 1
3: 13
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022515432 Original CRISPR GACCCAGATGTGCCTGCGTC AGG Intronic
900439572 1:2647108-2647130 GACCAAGATGTGCCTTCTTAGGG + Intronic
901186687 1:7378100-7378122 GACTCAGATGTGTCTGAGTGAGG - Intronic
904601318 1:31674156-31674178 GACCCCGATGGGCCTTGGTCAGG - Intronic
910952502 1:92666232-92666254 GTTCCAGATGAGCCTGAGTCTGG + Intronic
912043361 1:105419662-105419684 GACCCATCTGTGCCTGAGACAGG - Intergenic
912969521 1:114267535-114267557 GCCCCAGATGTTGCTGCATCTGG + Intergenic
915161460 1:153923220-153923242 GACCCGGATGTGTCTGGGACTGG - Intergenic
917300579 1:173570165-173570187 GACTCAGATGTGCTGGCTTCAGG - Intronic
919616902 1:199819236-199819258 GCCCCAGGTGTGTCTGTGTCCGG - Intergenic
920311820 1:205053029-205053051 GACCCAGATGTGCCTGGAGCTGG + Intronic
922006966 1:221541120-221541142 GACTCAGATGTGACTGAATCCGG - Intergenic
923045214 1:230350693-230350715 TACCCAGATGGGCTTGAGTCTGG + Intronic
923820726 1:237437340-237437362 GACCCAGATGTGGCTGGGCGCGG - Intronic
1063662870 10:8046011-8046033 AACCCAGATGTGTCTGCATCTGG + Intergenic
1064352425 10:14588550-14588572 GAGCCAGATGTGGGTGCCTCCGG - Intronic
1067223792 10:44362691-44362713 GCCCCAGATGTGGCCGCATCTGG + Intergenic
1069580111 10:69560016-69560038 GGCCCAGGTGTGCCTGGCTCTGG - Intergenic
1071474872 10:86017550-86017572 GACCCAGTTGTGCCTGCTCAAGG - Intronic
1075423983 10:122327552-122327574 GACCCTGGTCTGCCTGCCTCGGG + Intronic
1075784062 10:125036529-125036551 GACGCAGAAGTCCCTGTGTCAGG + Intronic
1076063795 10:127432530-127432552 GTCCCAGATGTGCCAACATCTGG + Intronic
1076248012 10:128962416-128962438 GACCCAGATGGGCCTGGCTGTGG - Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077165734 11:1137122-1137144 GACCCATAGTTGCCTGGGTCAGG + Intergenic
1077522687 11:3045654-3045676 GCATCAGATGTGCCTGTGTCTGG - Intronic
1078244612 11:9562956-9562978 GACTGAGATGTGCCAGCTTCAGG - Intergenic
1078269752 11:9784181-9784203 GCCCCAGATGTCCCTGAGTAAGG - Intronic
1078954857 11:16181009-16181031 GACCCAGATGTGTCTGTGTGGGG + Intronic
1083593444 11:63908176-63908198 GACCCAGATGAGAGTGGGTCTGG - Intronic
1083969360 11:66064038-66064060 GACCCAGATGATCCTGTGGCTGG - Intronic
1084957336 11:72698283-72698305 CACTCAGATGTGCCCGCCTCTGG + Intronic
1086436961 11:86791174-86791196 GACACAGATTTGCCTTCATCTGG + Intronic
1089499894 11:118925750-118925772 GACCCAGGCGTGCGGGCGTCCGG + Intronic
1089745565 11:120614461-120614483 GAGACAGAGGTGCCTGCATCTGG + Intronic
1096479164 12:51926489-51926511 GACCCAGCTTGGCCTGGGTCAGG + Intergenic
1101965877 12:109281584-109281606 GAGCAAGATGTGCCTGGGGCTGG + Exonic
1105882646 13:24617529-24617551 GATGCAGATGCACCTGCGTCTGG + Intergenic
1106128801 13:26922463-26922485 GAGCCAGAGGTTCCTGAGTCTGG - Intergenic
1106511578 13:30417903-30417925 TCCCCAGATGTGCCTGTCTCAGG + Intergenic
1107458052 13:40573256-40573278 GACACAGATGTGCCCACATCTGG - Intronic
1113416385 13:110131646-110131668 GACACCGTTGTGCCTGGGTCCGG - Intergenic
1117546444 14:56797927-56797949 GGCCCAGCTGGGCCTGCCTCGGG - Intergenic
1118744081 14:68761580-68761602 AAACCAGATGTGCCTGCCACAGG + Intergenic
1119406625 14:74403130-74403152 TTCCCAGCTCTGCCTGCGTCTGG - Intergenic
1123021987 14:105403160-105403182 GACCAAGCTGTGCCTACGTGTGG + Intronic
1135737211 16:24941675-24941697 GACCCAGATGTACGTGAGTGGGG - Intronic
1136685404 16:31991247-31991269 GATACAGACGTGCCTGCGTGGGG + Intergenic
1139422181 16:66855680-66855702 GACCCAGATGAGACAGCGGCAGG + Intronic
1140113707 16:72024030-72024052 AAACCAGATGTGCCTGGGCCGGG + Intronic
1141953230 16:87352875-87352897 AACCCAGATGTGCCGGCGCCTGG - Intronic
1144703785 17:17354395-17354417 GATCCAGATGTGCCCGTGGCAGG + Intergenic
1144855378 17:18264533-18264555 GACCCAGGTGGTCCTGCGTCTGG + Exonic
1145367625 17:22278196-22278218 GGCCCAGCTGTGCCTCCATCAGG - Intergenic
1148974026 17:51511161-51511183 CAGCCAGGTCTGCCTGCGTCTGG + Intergenic
1149840787 17:59963252-59963274 GACCCAGATGTCTTTGCTTCAGG + Exonic
1150244901 17:63667037-63667059 GACAGAGAGGTGCCTGCTTCTGG - Exonic
1152828315 17:82481272-82481294 GACACAGATCTGCCTGGCTCTGG - Intronic
1156493166 18:37508362-37508384 GGCCCAGAGGGGCCTGCCTCTGG - Intronic
1157574679 18:48735770-48735792 TACCCAAAGGTGCCTGGGTCTGG + Intronic
1159966597 18:74601106-74601128 GACACTGATGTGTCTGCTTCGGG + Intronic
1160751161 19:735318-735340 GGCCCACAGGTGCCTGTGTCCGG + Intronic
1161133912 19:2608519-2608541 GGCACAGGTGTGCCTGCATCTGG - Intronic
1161319437 19:3634189-3634211 TTCCCAGCTGTGCCTGCGTGAGG + Intronic
1161530358 19:4785331-4785353 GCCCGAGATGTGCCTGCGCATGG + Intergenic
1165313444 19:35041541-35041563 GACCCAGGTGTGCCTGTCTGCGG - Intronic
1165416828 19:35699600-35699622 GACCCAGATCTGCCTGACCCAGG - Intergenic
1165767975 19:38362555-38362577 GACCGAGTTCTGACTGCGTCCGG - Exonic
1166196163 19:41207207-41207229 GACCCAGATGTGTTTGCATTTGG - Exonic
1166528757 19:43529803-43529825 GACCCAGAGGTGACTCAGTCTGG + Intronic
1167476498 19:49704615-49704637 GCCCCAGATGCTCCTGCGTCAGG - Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
1168666785 19:58210362-58210384 GATACAGATGTGCCTGCCTGTGG - Intronic
929743986 2:44636359-44636381 GACCCAGATGTGCAAGAGTTTGG + Intronic
929758728 2:44788811-44788833 GAATCAGATGTGCCTGCATCTGG - Intergenic
931572257 2:63681071-63681093 GACCGAGATGTACCGGCTTCAGG + Intronic
932054913 2:68433645-68433667 GTCCCAGCTGTGCCTGTGGCTGG + Intergenic
935947608 2:108300481-108300503 GACCCCCATGTGCCTGCAGCAGG - Intronic
936974743 2:118207812-118207834 GACCCAGCTCTGGCTGCTTCTGG + Intergenic
937024214 2:118683909-118683931 GACCCTGATGTGTCTTCTTCAGG + Intergenic
939129806 2:138221514-138221536 GGCCTGGATGTGCCTGCCTCAGG - Intergenic
942204940 2:173610798-173610820 AACCCAGTTGTGCCTTGGTCTGG - Intergenic
948391672 2:237615970-237615992 GACTAAGATGTGCCAGTGTCTGG - Intergenic
948640825 2:239375167-239375189 CGCCCAGATGTGCCTGGGGCAGG + Intronic
1170134912 20:13062053-13062075 TACCCACACGTGCCTGCCTCAGG + Intronic
1170688128 20:18587768-18587790 GACCCAGATGTGGATGGGGCAGG + Intronic
1173148603 20:40546700-40546722 GTCTCAGATGAGCCTGCATCGGG - Intergenic
1175054665 20:56187340-56187362 GAGCCACATCTGCCTGCGACAGG + Intergenic
1178935035 21:36854358-36854380 GCCCCAGATGTGCCTGTCTCTGG - Intronic
1179823805 21:43952611-43952633 GACCAAGATGTGCTGGCGCCAGG + Intronic
1182119737 22:27779037-27779059 GACCCAGATGGGGCTGGTTCGGG - Intronic
1184028721 22:41878093-41878115 GATCCAGATCTGCCTGTTTCCGG - Exonic
1185376275 22:50483894-50483916 GACTCACATGTGCCTGCCACTGG + Exonic
950686549 3:14622343-14622365 GACCAAGATTTTCCTGCGCCTGG - Intergenic
950801092 3:15552356-15552378 GACTCAGATGTGCTGGCTTCAGG - Intergenic
953899776 3:46833573-46833595 GCCGCAGATGTGCCTGCCTTTGG + Exonic
957212933 3:77284373-77284395 TACCCAGATGTCCCTGCGTGTGG + Intronic
957425875 3:80038080-80038102 CACCCTGATGTGCTTGCTTCAGG + Intergenic
959409063 3:105997755-105997777 GACTCAGATGTGCTGGCTTCAGG - Intergenic
961325373 3:126106222-126106244 GACCCACATGTGCCCGCCGCAGG + Intronic
962314228 3:134349036-134349058 GACCCATGTGTGCCTGCCTGAGG + Intergenic
969102045 4:4776690-4776712 AACCCAGATCTGCCTGAGTGTGG + Intergenic
969501870 4:7558452-7558474 GACCCAGATGATCCTGCCCCAGG + Intronic
969840438 4:9877804-9877826 GACCCAGAAGAGCCTGGGACAGG - Intronic
971330453 4:25677231-25677253 GCCCCAGATCAGCCTGGGTCAGG + Exonic
975164869 4:71167160-71167182 GACTCACATGTGCCTGTGTTGGG + Intergenic
986508094 5:8473676-8473698 GCCCCACATGTGGCTGAGTCTGG + Intergenic
999280546 5:150362511-150362533 GCCCCAAATGTACCTGCTTCAGG + Intronic
1002878737 6:1233917-1233939 CAGGCAGATGTGCCTGGGTCAGG - Intergenic
1003140303 6:3465856-3465878 GAACCAGATGTGCTTGCTTGTGG + Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1011802838 6:91037100-91037122 GACCAAGACCTGCCTGAGTCAGG + Intergenic
1013651206 6:112196674-112196696 GACCCAGAGTTGACTGAGTCTGG - Intronic
1015693810 6:135957137-135957159 GAGACAGGTGTGCCTGGGTCCGG + Intronic
1019713263 7:2526935-2526957 GGCCCAGATGGGCTTGCGTAGGG + Intronic
1020046755 7:5046198-5046220 GACCCAGATCCGCCTCCCTCGGG - Exonic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1023987291 7:45104215-45104237 GACCCAGGTGTCCCAGCGCCTGG - Exonic
1027420795 7:78015798-78015820 GGGCCAGATGTGGCTGCATCTGG + Intergenic
1029696500 7:102217153-102217175 GACACAGATGGCCCTGCTTCAGG - Intronic
1035205135 7:157290047-157290069 GCCCCAGATGAGGCAGCGTCGGG - Intergenic
1035420480 7:158725479-158725501 AACTAAGATGTGCCTGCGTGTGG + Intergenic
1036655799 8:10676535-10676557 GACCCAGGTGTGCCTAAGGCTGG - Intronic
1036750474 8:11440542-11440564 GACCCAGCACTGCCTGCCTCTGG + Intronic
1039228787 8:35419954-35419976 GCCCCAGATGTGGCTGAGTCTGG + Intronic
1045651177 8:104342807-104342829 GACCAGGATGGGCCTGCGTCCGG + Intronic
1049555109 8:143277723-143277745 CCCCCAGATGTGCCTGTGGCGGG + Intergenic
1053267106 9:36723507-36723529 GACCCAGGTCTGCCTGCTCCTGG + Intergenic
1059382375 9:113936194-113936216 GACCCAGGTCTGTCTGCCTCTGG - Intronic
1059404576 9:114092045-114092067 GACCCAGATGGACCTGGGTGAGG - Intronic
1061012978 9:127966238-127966260 GACCTAGATGTGTCTGACTCTGG - Intronic
1061936306 9:133859327-133859349 GTCCCAGCTGTGCCCGTGTCAGG - Intronic
1196385085 X:115140392-115140414 GACTGAGATGTGCTGGCGTCCGG + Intronic
1200247410 X:154533520-154533542 GTCACAGATGGGCCTGCGACAGG + Intronic