ID: 1022517157

View in Genome Browser
Species Human (GRCh38)
Location 7:30983394-30983416
Sequence ACACTCACTGCTGACACTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022517157_1022517159 -7 Left 1022517157 7:30983394-30983416 CCATTAGTGTCAGCAGTGAGTGT 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1022517159 7:30983410-30983432 TGAGTGTATGATATTGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022517157 Original CRISPR ACACTCACTGCTGACACTAA TGG (reversed) Intronic