ID: 1022517157

View in Genome Browser
Species Human (GRCh38)
Location 7:30983394-30983416
Sequence ACACTCACTGCTGACACTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022517157_1022517159 -7 Left 1022517157 7:30983394-30983416 CCATTAGTGTCAGCAGTGAGTGT 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1022517159 7:30983410-30983432 TGAGTGTATGATATTGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022517157 Original CRISPR ACACTCACTGCTGACACTAA TGG (reversed) Intronic
903002518 1:20276357-20276379 ACACACAGTGCTGACCCTCATGG - Intergenic
903291193 1:22315345-22315367 ACACCCACCCCTGACACTTATGG + Intergenic
905645496 1:39622479-39622501 CCTCTCATTGATGACACTAACGG + Intergenic
908633432 1:66136077-66136099 ATACACACTGCTGACATCAAGGG - Intronic
908869889 1:68597410-68597432 ACACTCATGGGTGACTCTAAGGG + Intergenic
916889431 1:169102221-169102243 ACTCCCACTGATGACACGAATGG + Intergenic
918216264 1:182394022-182394044 ACACTCACCGTGGACACTACTGG - Intergenic
920188501 1:204177484-204177506 ACACTCCCTGCTGTCATTACTGG - Intergenic
921127034 1:212187273-212187295 ATACTCACTGCTGACTCAAGGGG - Intergenic
921227310 1:213032945-213032967 AGGCTCACTGCTGAAACTAAGGG - Intergenic
921825257 1:219665386-219665408 ACACACAATGCTGACCCTGATGG + Intergenic
924085809 1:240450605-240450627 AGCCTCACTGCTGGCCCTAAAGG - Intronic
924430925 1:243995759-243995781 ACTCACACTTCTGACACCAAAGG - Intergenic
1063805744 10:9638139-9638161 ACACTCTCTGCTAAGAATAATGG + Intergenic
1064676270 10:17763447-17763469 ACCCTCAATGCTGACAGTAAGGG + Intronic
1065252969 10:23835672-23835694 ACACTTACTGAAGACATTAAAGG - Intronic
1066419679 10:35253090-35253112 AAGTTCACTGCTGACACTATTGG + Intronic
1067880808 10:50043198-50043220 ACACACACTGGTGACCCTATAGG - Intergenic
1071478953 10:86048602-86048624 ACACTCCCAGCTGATGCTAAAGG + Intronic
1076602889 10:131670491-131670513 ACACTCAGTGCTGACTCCACAGG + Intergenic
1080056581 11:27912829-27912851 ACACTCCTAGATGACACTAATGG - Intergenic
1081138648 11:39470684-39470706 ACACTCCCTACTGACACTTTTGG + Intergenic
1083621459 11:64051405-64051427 ACACTCAGTGGTGACAGTGATGG + Intronic
1085538825 11:77246739-77246761 TCACTCTCTGCTGACTCTACTGG + Intronic
1086776228 11:90836465-90836487 TCACTCTCTGCTAACACTCATGG + Intergenic
1088353181 11:108912557-108912579 AAACTCACTGCTGTAAGTAAGGG - Intronic
1088603936 11:111511516-111511538 GCACCCATTGCTGACACCAAAGG - Intronic
1091617927 12:2064013-2064035 ACCCTCACTACTGACACAATAGG - Intronic
1093174187 12:15893106-15893128 ACCCTCACTGCTGTCTCTAGGGG - Intronic
1095133187 12:38567531-38567553 ACCCCCACTACTGACACTATGGG + Intergenic
1098283980 12:68889804-68889826 ACACACGCTGCTGACACAAGTGG - Intronic
1099671007 12:85692658-85692680 TCACACACTTCTGGCACTAAGGG + Intergenic
1101139560 12:101781226-101781248 AAACTCACTGCTGACATTCAGGG + Intronic
1103841560 12:123869475-123869497 ACACTCACTCCTGGCTCCAAAGG + Intronic
1107218089 13:37946214-37946236 ACTCTAAATGCTGACAGTAATGG - Intergenic
1113339911 13:109412368-109412390 ACACACACAGCAGACACTACTGG + Intergenic
1113650650 13:112031997-112032019 ACCGTCTCTGCTGACACTCACGG - Intergenic
1114392978 14:22330012-22330034 ACTCTCACTACTGGCACCAATGG - Intergenic
1117787020 14:59296668-59296690 ACTCTCACTGCTGTAACCAATGG - Intronic
1119116894 14:72031579-72031601 AGACTCCATGCTGACACTGATGG + Intronic
1120450408 14:84659505-84659527 ACATTCAAGGATGACACTAAAGG + Intergenic
1127571880 15:60251575-60251597 ACTTTCACTGCTGATAATAATGG + Intergenic
1132416543 15:101624257-101624279 AGACTTCCTGCTGACACCAAGGG + Intronic
1137761213 16:50941912-50941934 TCACTGAGTGCTGACACTGAAGG - Intergenic
1139115242 16:63943504-63943526 ACAATCTCTACTGACACCAATGG + Intergenic
1139967178 16:70752263-70752285 AGACCCAGTGCTGGCACTAATGG - Intronic
1141902365 16:86999898-86999920 AAACTCACTGCAGACGCCAAAGG - Intergenic
1143640506 17:8193949-8193971 AGACTCAGTGCTGAGATTAAAGG + Intergenic
1146233485 17:31134559-31134581 ACACTCAGTTCAGCCACTAATGG - Intronic
1148067942 17:44886818-44886840 ACAGTCAGTGCTGTCACTCACGG - Intronic
1152783256 17:82235742-82235764 ACCCTCACAGCTGGCTCTAAAGG - Exonic
1153660432 18:7321006-7321028 ACACTCTCTGCTCACATGAAAGG + Intergenic
1153676007 18:7456164-7456186 GCACTCACTACTGACACCACAGG + Intergenic
1153923926 18:9816142-9816164 ACACTCAGGGATGACACTCAGGG - Intronic
1159908912 18:74125093-74125115 AGATTCACAGCTGACACTGATGG + Intronic
1160841021 19:1147088-1147110 GGGCTCACTGCTGACACGAAGGG + Intronic
1163132462 19:15283825-15283847 ACACTCACTGGGGACACAAAAGG + Intronic
1165153503 19:33774179-33774201 ACATTGACTGCTGACACTTCTGG - Intergenic
925863174 2:8200081-8200103 ACAATCACGGCTGAAGCTAAAGG + Intergenic
926429350 2:12769914-12769936 ACAGTCACTGCTGTCTCTGAAGG + Intergenic
926583674 2:14661473-14661495 ACACTCACTGGGGGCACTGAGGG - Intergenic
927926515 2:27017415-27017437 ACAGGCACTGCTGCCACTCATGG + Intronic
929404572 2:41626757-41626779 ATACTCACTACTGACTCTAGGGG + Intergenic
930284178 2:49407399-49407421 CCACACACTGCTTAGACTAAGGG - Intergenic
935298759 2:101674285-101674307 ACACACACTGCTGTCACCACTGG + Intergenic
937514129 2:122632825-122632847 ACACTCATTTCTAACATTAATGG + Intergenic
939200614 2:139030253-139030275 ACAATTATTGCTGACATTAATGG - Intergenic
943263184 2:185692640-185692662 ACAGGCACTGCTCACACTCAAGG - Intergenic
946940472 2:224764528-224764550 ACACTCCCTGCTAACGCTATTGG - Intergenic
1168910838 20:1445460-1445482 ACAGTCACTGGCCACACTAATGG + Intronic
1170484291 20:16800441-16800463 AAAGTCACTGCTGAACCTAAAGG - Intergenic
1173153918 20:40591866-40591888 ACTTTCACTGCTGACACCCAAGG - Intergenic
1173590874 20:44223812-44223834 ACACACACTGCTGAGAGTAACGG - Intergenic
1174918991 20:54682259-54682281 ACACTCATTCCTGACATCAAAGG - Intergenic
1177028022 21:15945842-15945864 ACACTCACTGGTGTCAAGAAAGG - Intergenic
1180328032 22:11449492-11449514 ACCCTCACAGATGACACTGAGGG - Intergenic
1184374777 22:44104809-44104831 ACCCTCACTTCTGACACCAATGG + Intronic
1185032579 22:48452277-48452299 GTGCTCACTGCTGACCCTAATGG - Intergenic
949210342 3:1491572-1491594 AGAGTCAGTGCTGACACCAAAGG + Intergenic
949395778 3:3613542-3613564 TCTCTCACTGCTGCCACCAATGG - Intergenic
950582941 3:13874510-13874532 CCATTCACTGCTGCAACTAAAGG + Intronic
952143208 3:30502229-30502251 ACACCAACTCCTGACACTACTGG + Intergenic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
955407867 3:58636733-58636755 ACATACACTGATCACACTAAGGG - Intronic
955773492 3:62409524-62409546 ACAATCATTGCTGACTCTTAAGG + Intronic
957093744 3:75758168-75758190 ACCCTCACAGATGACACTGAGGG + Intronic
957593560 3:82231389-82231411 ACACTCACTGCAGATACTTCAGG + Intergenic
957718839 3:83968891-83968913 CCACTCTCTGGTGAAACTAAGGG + Intergenic
963026329 3:140922893-140922915 ACCCTCACTGATGATACTGAGGG - Intergenic
963162799 3:142169116-142169138 ACAATCACTGCTGGCAATAAAGG - Intronic
963943864 3:151123709-151123731 ACAGGCACTCCTAACACTAAAGG - Intronic
967898647 3:194423607-194423629 ACACAAGCTGCTGACAGTAACGG + Intronic
968107362 3:196011100-196011122 ATAGACACTGCAGACACTAAGGG + Intergenic
969452311 4:7281651-7281673 CCACTCACTGCCCACACAAACGG - Intronic
971240364 4:24883038-24883060 GCATTCAGTGCTGACTCTAAAGG - Intronic
972526015 4:39912238-39912260 ACACTCACTGCTAACTGTAGTGG - Intronic
982097996 4:151940942-151940964 ACATTCAATGCTGACATTAAAGG + Intergenic
984719759 4:182958804-182958826 GCACTCACTGGTGACACTTGTGG - Intergenic
986322365 5:6642915-6642937 TCATTCACTGTTGACACTATGGG + Intronic
990975987 5:61562387-61562409 ATACTCACTTCTGCCACTACTGG + Intergenic
992861221 5:80912455-80912477 ACACACACAGCTGACAGTACTGG + Intergenic
993141334 5:84037917-84037939 AAGCTCACTGCTCACATTAATGG - Intronic
993726514 5:91374163-91374185 ACACTGACTGCTTACACTTGAGG + Exonic
995363116 5:111321601-111321623 ACACCCACTGCTGTTTCTAAAGG - Intronic
995542914 5:113201919-113201941 ACACTCACTCCAGCCAATAAAGG + Intronic
996875836 5:128239453-128239475 AAACTCAATGATGACACTCAAGG - Intergenic
999783745 5:154872609-154872631 AGACTCACTGCTGACAGGAATGG + Exonic
1002960377 6:1908877-1908899 TGACTCACGGCTGACCCTAAAGG + Intronic
1006792443 6:36712841-36712863 ACCATCACTGCTGCCACCAATGG + Intronic
1008542638 6:52558389-52558411 ACACTCCCTGCTCAGTCTAATGG - Intronic
1012287237 6:97406033-97406055 AAGATCACTGCTGACACTACTGG - Intergenic
1015120264 6:129693317-129693339 ACCATCACTGCTGGCATTAATGG - Intronic
1015738239 6:136424435-136424457 ACACTCACATGTGACACTAATGG - Intronic
1020523889 7:9232395-9232417 ACACTCACTGATTAAACTTAAGG - Intergenic
1021039621 7:15846005-15846027 ACACTCACTGCTGTTTCTAAAGG - Intergenic
1022517157 7:30983394-30983416 ACACTCACTGCTGACACTAATGG - Intronic
1024361667 7:48475128-48475150 AAACACACTGCTGCCACAAAAGG - Intronic
1026385409 7:69842646-69842668 ACACTCACTGGTGTCACTGATGG - Intronic
1027714723 7:81655475-81655497 ATACTCACTGCTGAAGCTGAAGG - Intergenic
1028255859 7:88597204-88597226 ACACACACTGCAGACTCCAAAGG + Intergenic
1029503959 7:100950819-100950841 ACACTCACTGCTAAGCCTTAAGG + Intronic
1031678547 7:124641647-124641669 TCACCCACTCCTGTCACTAAAGG - Intergenic
1043611942 8:82075613-82075635 ACAATCACTTCTTCCACTAAGGG + Intergenic
1044201093 8:89438412-89438434 ATACTCACTCCTGAAAATAATGG - Intergenic
1045168453 8:99634742-99634764 ACATTAATTGGTGACACTAAAGG + Intronic
1046565954 8:115901496-115901518 ATAATCCCTGCTGACATTAATGG + Intergenic
1046660157 8:116939758-116939780 AGACTCACTGCTTAGACTCAGGG - Intronic
1055126104 9:72719453-72719475 ACACTCACTGGGGAACCTAAAGG - Intronic
1055400803 9:75921983-75922005 AAACTCACAGTTGACACCAAGGG + Intronic
1056886096 9:90445469-90445491 CCACTCACTGCTGATATTCAAGG + Intergenic
1056927149 9:90844519-90844541 ACCCACACTGCTGGCACAAAGGG - Intronic
1061711594 9:132491647-132491669 ACTCTGACTGCTGTCACTCATGG + Intronic
1203483694 Un_GL000224v1:31566-31588 ACCCTCACAGATGACACTGAGGG - Intergenic
1192264934 X:69531512-69531534 ACAGGCCCTGCTGGCACTAAAGG - Exonic
1200850308 Y:7876402-7876424 GCACACCCAGCTGACACTAAAGG - Intergenic
1201931161 Y:19350407-19350429 TCACTCACTGGTGACTCTCAGGG + Intergenic