ID: 1022517159 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:30983410-30983432 |
| Sequence | TGAGTGTATGATATTGGCAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1022517157_1022517159 | -7 | Left | 1022517157 | 7:30983394-30983416 | CCATTAGTGTCAGCAGTGAGTGT | 0: 1 1: 0 2: 0 3: 12 4: 123 |
||
| Right | 1022517159 | 7:30983410-30983432 | TGAGTGTATGATATTGGCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1022517159 | Original CRISPR | TGAGTGTATGATATTGGCAG TGG | Intronic | ||