ID: 1022517853

View in Genome Browser
Species Human (GRCh38)
Location 7:30987240-30987262
Sequence CACACCCACCTGCCAGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 549}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022517853_1022517865 5 Left 1022517853 7:30987240-30987262 CCAGAGGCTGGCAGGTGGGTGTG 0: 1
1: 0
2: 4
3: 63
4: 549
Right 1022517865 7:30987268-30987290 TGGGGGTGGGCAGGAGAGGGAGG 0: 2
1: 1
2: 26
3: 303
4: 2345
1022517853_1022517861 -4 Left 1022517853 7:30987240-30987262 CCAGAGGCTGGCAGGTGGGTGTG 0: 1
1: 0
2: 4
3: 63
4: 549
Right 1022517861 7:30987259-30987281 TGTGTGGCCTGGGGGTGGGCAGG No data
1022517853_1022517862 1 Left 1022517853 7:30987240-30987262 CCAGAGGCTGGCAGGTGGGTGTG 0: 1
1: 0
2: 4
3: 63
4: 549
Right 1022517862 7:30987264-30987286 GGCCTGGGGGTGGGCAGGAGAGG No data
1022517853_1022517866 16 Left 1022517853 7:30987240-30987262 CCAGAGGCTGGCAGGTGGGTGTG 0: 1
1: 0
2: 4
3: 63
4: 549
Right 1022517866 7:30987279-30987301 AGGAGAGGGAGGCCAACTGCTGG 0: 1
1: 0
2: 3
3: 21
4: 338
1022517853_1022517863 2 Left 1022517853 7:30987240-30987262 CCAGAGGCTGGCAGGTGGGTGTG 0: 1
1: 0
2: 4
3: 63
4: 549
Right 1022517863 7:30987265-30987287 GCCTGGGGGTGGGCAGGAGAGGG No data
1022517853_1022517860 -8 Left 1022517853 7:30987240-30987262 CCAGAGGCTGGCAGGTGGGTGTG 0: 1
1: 0
2: 4
3: 63
4: 549
Right 1022517860 7:30987255-30987277 TGGGTGTGTGGCCTGGGGGTGGG No data
1022517853_1022517859 -9 Left 1022517853 7:30987240-30987262 CCAGAGGCTGGCAGGTGGGTGTG 0: 1
1: 0
2: 4
3: 63
4: 549
Right 1022517859 7:30987254-30987276 GTGGGTGTGTGGCCTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022517853 Original CRISPR CACACCCACCTGCCAGCCTC TGG (reversed) Intronic
900393193 1:2442774-2442796 CAGACCCTCCTGGCAGACTCTGG - Intronic
900503377 1:3017306-3017328 CCCACCCACCTCCCATCCCCGGG - Intergenic
900603145 1:3511762-3511784 TCCACCCAGCAGCCAGCCTCGGG + Intronic
900761553 1:4475267-4475289 CACAGCCACCTGCTAACCCCTGG - Intergenic
900870649 1:5300013-5300035 CCCACCTTCCTGCCAACCTCTGG - Intergenic
901446103 1:9309012-9309034 CAAACCCTCCTGACAGTCTCAGG - Intronic
901679493 1:10904850-10904872 CACACCATCCAGCCTGCCTCAGG + Intergenic
901689908 1:10966005-10966027 CACACCCACAGGCTTGCCTCAGG - Intronic
901762620 1:11480408-11480430 CACACCCACCCACAATCCTCAGG + Intronic
902620833 1:17649925-17649947 CTCACCCACCAGCGAACCTCGGG - Intronic
902856504 1:19210150-19210172 CACAGCCACCTCCCAGCCCGGGG + Exonic
902929069 1:19717612-19717634 CACATGCACCTTCCTGCCTCTGG + Intronic
904393415 1:30200349-30200371 ATCACCCACCTAACAGCCTCAGG + Intergenic
904605992 1:31697980-31698002 CTCAGCCTCCTCCCAGCCTCTGG - Exonic
904618123 1:31760837-31760859 CACACCCTCCATCCTGCCTCCGG + Intronic
904625249 1:31798662-31798684 CCCACCCAGCTGCCTCCCTCTGG - Intronic
904717744 1:32481752-32481774 CTCTCCCACCTCCCACCCTCCGG + Intronic
904859046 1:33521151-33521173 CACACCCTCCAGCCAGCCCTGGG - Intronic
905414643 1:37795423-37795445 CACACCCACCTGGAAGCCACAGG - Intronic
905875137 1:41427494-41427516 CTCACCCATCTCCCATCCTCAGG + Intergenic
905964017 1:42074627-42074649 CACACACCCTTCCCAGCCTCTGG + Intergenic
906149038 1:43577190-43577212 CACACCCCCCTGCCTCACTCAGG + Intronic
906157042 1:43619905-43619927 CACCCCCACCAGCCAGGCACAGG - Intronic
906986907 1:50692457-50692479 CACACCCCACCACCAGCCTCTGG + Intronic
907242558 1:53088838-53088860 TCCACCCTCCTGGCAGCCTCTGG + Intronic
907334057 1:53688934-53688956 CACACCCCCAGGCCAGACTCTGG + Intronic
907850484 1:58250329-58250351 CACACGGACCTGCCAGCCCCAGG - Intronic
908781669 1:67696619-67696641 CAAACCCACGTGCCCTCCTCTGG + Intergenic
909519571 1:76551841-76551863 CACACACACTTCACAGCCTCTGG + Intronic
909564419 1:77039109-77039131 CCCACCCACCTGCCTCCCACTGG + Intronic
909620658 1:77663021-77663043 AACTTCCACCTGCCAGCCCCAGG - Intronic
910127658 1:83861071-83861093 CAGGCCCACGTGCCAGGCTCCGG - Intergenic
910873261 1:91854061-91854083 CACCCCCACTCCCCAGCCTCTGG - Intronic
911950944 1:104172695-104172717 CACACACACCTGCACTCCTCAGG - Intergenic
912007660 1:104923838-104923860 CACACTCACCTCTCAACCTCTGG + Intergenic
912302590 1:108533531-108533553 CACTCACACCTGCCATCCTCCGG + Intergenic
912439909 1:109689962-109689984 CCCAAGCACCTGGCAGCCTCTGG - Intronic
915031393 1:152883114-152883136 GGCAACCACCTTCCAGCCTCTGG - Intronic
915529235 1:156493892-156493914 CTCCCCCACCTGTCAGCCTGGGG - Intronic
916074605 1:161193245-161193267 CAAACTCACCTGCCAGGCCCAGG - Exonic
916493909 1:165327616-165327638 CCCTCCCAACTGACAGCCTCAGG + Intronic
916766128 1:167862461-167862483 CATGCCCACCTGCTAGCTTCTGG - Intronic
917725886 1:177826668-177826690 CACACCCACCTGCTTGTCACTGG + Intergenic
918266409 1:182846036-182846058 CGGTCCCACCTCCCAGCCTCTGG - Intronic
919477406 1:198046058-198046080 CACACACTCTTGCGAGCCTCTGG + Intergenic
919640596 1:200040971-200040993 CAGACCCACAGGTCAGCCTCCGG - Intronic
919766896 1:201133343-201133365 TACACCCACCTGCCCACCTTTGG + Intergenic
920038696 1:203082421-203082443 CCCACCCACCTTCTAACCTCAGG + Intergenic
920176105 1:204102943-204102965 CACACCCACCCACCTGCCTCCGG + Intronic
921076030 1:211700924-211700946 CCCACCCACCCTTCAGCCTCTGG + Intergenic
921113378 1:212061838-212061860 CCCACTCACTTTCCAGCCTCTGG - Intronic
922859291 1:228802388-228802410 CACAACCCCCTACCAGCCTTTGG + Intergenic
923355869 1:233154992-233155014 CTCACCCAACTTCCACCCTCTGG - Intronic
923475136 1:234324947-234324969 CACAGCCGCCTGCCTGCCTTGGG + Intergenic
923546185 1:234925068-234925090 CACACCACACTGCCAGCTTCGGG + Intergenic
924812556 1:247416176-247416198 CTTACCCAGATGCCAGCCTCAGG - Intronic
924875358 1:248097307-248097329 CACACTCACCTGATAGCCACAGG + Intronic
1062834352 10:626300-626322 CAATCCCAGCTGCCAGGCTCTGG + Intronic
1062939790 10:1412713-1412735 CACACCCACCTGCCCCGCCCAGG - Intronic
1063199825 10:3777242-3777264 CACACCCACAAGCCAGCAGCTGG + Exonic
1063234805 10:4102498-4102520 TACACCTACCTGGCAGCCACCGG + Intergenic
1063376561 10:5557871-5557893 CACAGCCTCCTGGCAGCCTCAGG - Intergenic
1064316998 10:14267045-14267067 CACACCTATCTGCCTGCCCCAGG - Intronic
1064997925 10:21312871-21312893 CACACCTCCTTCCCAGCCTCTGG + Intergenic
1065041179 10:21698223-21698245 CTCACACTCTTGCCAGCCTCTGG + Intronic
1065316107 10:24465495-24465517 CACACCCAACTACCACGCTCTGG - Intronic
1065328754 10:24572174-24572196 CACACCTCAGTGCCAGCCTCTGG + Intergenic
1067023953 10:42827434-42827456 CACACCCTTCTTCCATCCTCAGG - Intronic
1067572472 10:47381523-47381545 CAGTGCCACCAGCCAGCCTCTGG - Intronic
1068591069 10:58853706-58853728 CACACTACCCTCCCAGCCTCTGG + Intergenic
1068961796 10:62874051-62874073 CACACACCCCTCACAGCCTCTGG + Intronic
1070751218 10:78965144-78965166 CACAGCTCCCTGCCAGGCTCTGG - Intergenic
1070791488 10:79192127-79192149 CAAACCCCCCTGCCATCCTCTGG - Intronic
1071463700 10:85921252-85921274 GACACCCACATTCCACCCTCTGG + Intronic
1071464302 10:85925492-85925514 CACAGCCACCTGCCACCCCAGGG - Intronic
1072363512 10:94684354-94684376 CATCTCCACCTGCCAGCCTCTGG + Intronic
1072551092 10:96478199-96478221 CACTCCCATCTGCCAACCTTGGG + Intronic
1072923854 10:99598958-99598980 CACATACTCCTGCCAGCCGCTGG - Intergenic
1073288803 10:102403259-102403281 CAAACCCTCCAGCCAGCCCCGGG - Exonic
1074533205 10:114310956-114310978 CCCACCCGCCCGCCCGCCTCTGG + Intronic
1074868321 10:117557930-117557952 CACATCCACTTGTCAGCCTCAGG + Intergenic
1075157230 10:119988454-119988476 CACAGGCACTTACCAGCCTCTGG - Intergenic
1075425238 10:122337051-122337073 CAGACCCACCTGCCTCACTCAGG + Intronic
1075583938 10:123643714-123643736 CTCTCCCGCCTCCCAGCCTCAGG + Intergenic
1076267711 10:129121817-129121839 CACACCCAGCTGCTGGCCACAGG + Intergenic
1076627519 10:131831164-131831186 CTCACCACCCTGCCAGCCTCGGG + Intergenic
1076978760 11:194275-194297 CACACACACCTCCCAGCTGCTGG + Intronic
1077040733 11:520874-520896 CGCACCCACCCGCCAGCTGCTGG + Intergenic
1077309996 11:1884085-1884107 CAATCCCACATGCCAGCCACAGG + Intronic
1077551225 11:3201145-3201167 CACTGCCACCTTCCAACCTCAGG + Intergenic
1077843091 11:5995891-5995913 CCCTCCCACCTACCAGACTCTGG + Intergenic
1078546274 11:12249300-12249322 CAGACCCACCTGCAGGGCTCTGG + Intronic
1078930376 11:15907881-15907903 CACACACACCAGCCAGCCCTAGG + Intergenic
1079106076 11:17573269-17573291 CGCGCCCGCCTGCCAGCCTGTGG + Exonic
1079237288 11:18699595-18699617 AGCAACCACCTGCCAGCCCCTGG - Intronic
1079373072 11:19868568-19868590 CACACCCATCTACCAGCAGCTGG - Intronic
1080128410 11:28765375-28765397 CACATCAACGTGCCAGCATCTGG - Intergenic
1080318542 11:30978823-30978845 CACACCCCCTTCTCAGCCTCTGG + Intronic
1080461028 11:32455156-32455178 GCCACCCACCTTCCTGCCTCAGG - Intergenic
1080581299 11:33646050-33646072 TCCACCCACCTGCCATCATCTGG + Intronic
1080581834 11:33650749-33650771 CACACGCACCTGCCCCTCTCCGG + Intronic
1080586519 11:33687864-33687886 GACAGCCACCTGCAGGCCTCTGG + Intergenic
1080801472 11:35614090-35614112 CAGAGCCTCCAGCCAGCCTCGGG - Intergenic
1082854178 11:57791652-57791674 CACACTCACCCGCCGGCATCAGG + Exonic
1082903083 11:58277483-58277505 CACACCCCTCTGACAGGCTCTGG + Intergenic
1082974153 11:59055622-59055644 CACACCCTCCTGCTATCCTTTGG + Intergenic
1084114588 11:67034657-67034679 GACACCCACCTCCCAGCCAGGGG - Exonic
1084151634 11:67290239-67290261 GCCCCCCGCCTGCCAGCCTCAGG - Intronic
1084400443 11:68939997-68940019 AAAACCCACATCCCAGCCTCTGG + Exonic
1084409306 11:68997199-68997221 CACCCCCAACTGCCTGCCTGGGG + Intergenic
1084462925 11:69306345-69306367 CCAAGCCACCTGCCAGCATCCGG - Intronic
1084653507 11:70502361-70502383 GAGACCCACCTGCCAGCCACAGG - Intronic
1084750288 11:71200122-71200144 AGCAGCCACCTCCCAGCCTCTGG + Intronic
1084857438 11:71998030-71998052 CCCACCCCCCTGTCAGGCTCAGG + Intergenic
1085516097 11:77112805-77112827 CCCACCCACCTGCCTGCTGCTGG - Intronic
1085532754 11:77201647-77201669 CCCACCCATCTGCCACCCCCAGG - Intronic
1087064155 11:94011704-94011726 CACACCCTCCACCCAGCCCCTGG - Intergenic
1087205290 11:95387648-95387670 CACACCTGCCTGACAGCCTTGGG + Intergenic
1087299936 11:96420652-96420674 CTCACCCATTTCCCAGCCTCTGG - Intronic
1088847852 11:113682708-113682730 CCCAGCCACATGCCAGGCTCAGG - Intergenic
1090441647 11:126729637-126729659 CACACCCACCTGTGAGCTCCTGG - Intronic
1090640481 11:128725423-128725445 ACCACTCACCTGTCAGCCTCAGG + Intronic
1091218133 11:133916078-133916100 CAGACCCACCTGCCTCCCTGCGG + Intronic
1091664574 12:2410048-2410070 CATCCTCACCTGCCAGCCGCGGG + Intronic
1091676372 12:2493585-2493607 CTCCCCCACCCGCCAGCCTTAGG + Intronic
1091683279 12:2541994-2542016 CCCATCCTCCTGCCAGTCTCAGG + Intronic
1093656922 12:21705609-21705631 CACACACTCTTCCCAGCCTCTGG + Intronic
1094598229 12:31884767-31884789 CCCACCCAGCTTCTAGCCTCTGG - Intergenic
1095221771 12:39624668-39624690 CATCCCCCACTGCCAGCCTCTGG + Intergenic
1095322399 12:40845638-40845660 CATTTCCACCCGCCAGCCTCTGG + Intronic
1095823990 12:46512415-46512437 CAAACCCACCTTCCATCCTGGGG + Intergenic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1096553394 12:52388940-52388962 CACCTCCACCAGACAGCCTCTGG - Intergenic
1096700903 12:53382053-53382075 GACACCCAGCTGCCAGCCTAGGG - Intronic
1096872893 12:54605253-54605275 CCCAACCAGCTGCCAGGCTCTGG - Intergenic
1097778516 12:63675781-63675803 CCCTCCCTCCTTCCAGCCTCTGG + Intergenic
1098041994 12:66361892-66361914 CACACCCTCCACCCACCCTCGGG + Intronic
1098194029 12:67980451-67980473 CATACACACCTCCCAACCTCTGG - Intergenic
1098255150 12:68609183-68609205 CGCCCCCACCTCCCACCCTCGGG - Intergenic
1098823846 12:75268732-75268754 CAGCCCTACCTGCCAGCCTACGG - Intergenic
1099135565 12:78894754-78894776 CATCCCCACCTCCCAGTCTCTGG - Intronic
1099348483 12:81534151-81534173 CACACACCCTTCCCAGCCTCTGG - Intronic
1099370894 12:81828696-81828718 CACACACCCTTTCCAGCCTCTGG + Intergenic
1102149024 12:110676037-110676059 CACACCCAGCTGCAAGTCTGTGG - Intronic
1102253796 12:111405134-111405156 CCCACCCCCCTGCCCGCCCCCGG - Intergenic
1102472572 12:113167918-113167940 CAGCCCCACCTGGCAGCCCCAGG - Intronic
1102514177 12:113435389-113435411 CACCCCCAACTGCCAGCACCAGG - Exonic
1102974322 12:117195556-117195578 CACACACTCATGCCAGCCTGGGG + Intergenic
1103316179 12:120057713-120057735 CACAGCCACCTTCCAGCCAGGGG - Intronic
1103967141 12:124647013-124647035 GACTCCGACCTGCCGGCCTCTGG + Intergenic
1104077764 12:125405566-125405588 CACACCAGCCTGCCAGGTTCAGG - Intronic
1104344128 12:127980546-127980568 CACACCCCCTTTCCAGTCTCTGG + Intergenic
1104680772 12:130749928-130749950 CACACCCATGACCCAGCCTCAGG - Intergenic
1104690558 12:130822770-130822792 CACACACACATTGCAGCCTCTGG - Intronic
1104757067 12:131276003-131276025 CTGCCCCACCTGCCAGCCTTTGG - Intergenic
1104933921 12:132354591-132354613 CACGCCCTGCTCCCAGCCTCTGG + Intergenic
1105341135 13:19527157-19527179 GACACGCACTTCCCAGCCTCTGG - Intronic
1106592712 13:31111005-31111027 GACACCCAGCTCCTAGCCTCCGG - Intergenic
1107209179 13:37831870-37831892 TCCACCCTCCTGCCAGACTCTGG - Intronic
1107932195 13:45315583-45315605 CGCACCCACCTCCCAGCTACAGG - Intergenic
1109094173 13:58090014-58090036 CTTCCCCACCTCCCAGCCTCTGG - Intergenic
1110317952 13:74133068-74133090 AACAGCCACCGGCCAGCCCCTGG + Intronic
1110762325 13:79244341-79244363 AACCCCCACCTCCCAGGCTCAGG + Intergenic
1111176466 13:84602664-84602686 CACACACACTTCCCAGCCTCTGG + Intergenic
1112428535 13:99328009-99328031 CACATCCAGCTGCCAGCCGCAGG + Intronic
1112986438 13:105455909-105455931 CATACACACTTCCCAGCCTCTGG - Intergenic
1113068211 13:106392955-106392977 CACACCCCTCTTCCAGCTTCTGG + Intergenic
1113706246 13:112434593-112434615 AACCCCCACCCACCAGCCTCCGG + Exonic
1113823848 13:113234765-113234787 CACACCCTCCTCCCATCCCCAGG - Intronic
1113966427 13:114155858-114155880 CACACCCACCCTCCACCCCCAGG - Intergenic
1113969386 13:114177031-114177053 CACTCACAGCTGCCACCCTCAGG - Intergenic
1113969449 13:114177310-114177332 CACTCACAGCTGCCACCCTCAGG - Intergenic
1113969463 13:114177363-114177385 CACCCACAGCTGCCACCCTCAGG - Intergenic
1114368184 14:22053450-22053472 CCCACCCTCCTCCCAGCCTCTGG + Intergenic
1114762900 14:25336847-25336869 CACACACCCTTCCCAGCCTCTGG - Intergenic
1116279999 14:42894497-42894519 CACACCCTCCCTCCACCCTCTGG + Intergenic
1116930091 14:50682186-50682208 CCCACCACCCTCCCAGCCTCTGG + Intergenic
1117744474 14:58854237-58854259 CACACACCCTTCCCAGCCTCTGG + Intergenic
1118502965 14:66380457-66380479 CACACACACGTGCCACCCTGGGG + Intergenic
1118760521 14:68878160-68878182 CAGTCCTTCCTGCCAGCCTCAGG + Intronic
1118867093 14:69712286-69712308 CACACCCCTCTGCCCACCTCAGG - Exonic
1119480869 14:74956821-74956843 CACAGCCACCCACCAGCCCCAGG - Intergenic
1120025537 14:79579945-79579967 CACACACCCATTCCAGCCTCTGG + Intronic
1121310574 14:92933191-92933213 CACAGCCTCCTCCCAGGCTCAGG + Intronic
1121400509 14:93672500-93672522 CACACACCCTTCCCAGCCTCTGG - Intronic
1121541186 14:94728005-94728027 CACACCGTACTCCCAGCCTCAGG - Intergenic
1121580532 14:95026335-95026357 AGCACCCACCTGCCAGTCACAGG + Intergenic
1121594371 14:95148266-95148288 CAGACCCACCCTCCAACCTCTGG - Intronic
1121865786 14:97361356-97361378 CACACACATATGCCTGCCTCCGG + Intergenic
1122059228 14:99125401-99125423 CACACCATCATGACAGCCTCCGG - Intergenic
1122488076 14:102094975-102094997 CTCACCCACCCGGGAGCCTCTGG - Intronic
1122736547 14:103847123-103847145 CGCCCCCACCTGCCCGCCTGGGG + Intronic
1122828214 14:104382600-104382622 CACACCCCACAGCCGGCCTCTGG - Intergenic
1122888127 14:104719560-104719582 CGCATCCAGCCGCCAGCCTCAGG - Exonic
1123735690 15:23180342-23180364 CAACCGCAGCTGCCAGCCTCTGG - Intergenic
1123995689 15:25716405-25716427 CACACCCACCTGCCTACCTGAGG + Intronic
1124286405 15:28403325-28403347 CAACCGCAGCTGCCAGCCTCTGG - Intergenic
1124296298 15:28508311-28508333 CAACCGCAGCTGCCAGCCTCTGG + Intergenic
1125810633 15:42537886-42537908 TACACCCACTACCCAGCCTCTGG - Exonic
1126202072 15:45997797-45997819 CACACAAACTTTCCAGCCTCTGG + Intergenic
1128168276 15:65486826-65486848 CACACCCACCACCCTTCCTCTGG - Intronic
1128758334 15:70198028-70198050 CACACACCCATGCCAGCCTCTGG - Intergenic
1129221897 15:74136032-74136054 AACACCCCCTTCCCAGCCTCTGG + Exonic
1129465800 15:75723635-75723657 CCCACCTACCTCCCAGGCTCTGG - Intergenic
1129717802 15:77862231-77862253 TGCACCCACCTCCCTGCCTCAGG - Intergenic
1130460967 15:84158030-84158052 TGCACCCACCTCCCTGCCTCAGG + Intergenic
1130914295 15:88292402-88292424 TACACCCACCTGCGACCCTAGGG + Intergenic
1130932852 15:88442746-88442768 CACACACACCTGGCAACCTCAGG + Intergenic
1132143115 15:99410753-99410775 CACGCCCACCTCCAAGCCACTGG - Intergenic
1132208331 15:100001933-100001955 CACTCCAGCCTGCCAGCCTTGGG + Intronic
1132635992 16:946932-946954 CTCACCCACCTGCCAGGCTCTGG + Intronic
1132649967 16:1016171-1016193 CTCGCCCACCTGCCTGCTTCAGG - Intergenic
1132834553 16:1946281-1946303 CACACCCACATGACAGCAGCTGG + Intronic
1132973841 16:2701855-2701877 CACTCCAACCTGCCTCCCTCCGG - Intronic
1132976709 16:2714682-2714704 CAGCCCCACCTGCGGGCCTCTGG + Intronic
1133232528 16:4373314-4373336 CGCACACACATGCCAGCCTGGGG + Intronic
1133755146 16:8757118-8757140 CACACTCCCCAGCCAGCCCCAGG + Intronic
1133802450 16:9094520-9094542 CACCCCCACCTCCCAGTCCCTGG + Intronic
1135205633 16:20481554-20481576 CACACACCCTTCCCAGCCTCTGG - Intronic
1135213279 16:20542259-20542281 CACACACCCTTCCCAGCCTCTGG + Intronic
1135252960 16:20916527-20916549 CACACCCTCCCGCCAGCTGCAGG + Intronic
1135590936 16:23704931-23704953 CACATCCGACTGCCTGCCTCAGG - Exonic
1136142404 16:28295882-28295904 CAAACCCAGATGCCAGCATCGGG - Intronic
1136292263 16:29282258-29282280 CTCATCCTCCTGCCAGCCCCGGG + Intergenic
1137306553 16:47206530-47206552 TACTCTCACCTACCAGCCTCTGG + Intronic
1137957356 16:52845403-52845425 CACACACCCTTTCCAGCCTCTGG + Intergenic
1138519524 16:57563157-57563179 GACACCCACCATCCAGTCTCTGG + Exonic
1138817039 16:60214536-60214558 GACACCCACATGCAAGTCTCAGG - Intergenic
1138838465 16:60467847-60467869 CTCCCCCAACTCCCAGCCTCTGG - Intergenic
1138862881 16:60779811-60779833 CACACACACTTACCAACCTCTGG - Intergenic
1139476373 16:67204505-67204527 CACATCCTCCTACCAGCCTGGGG - Intergenic
1139964784 16:70739282-70739304 CACTCACCCCTCCCAGCCTCAGG - Intronic
1140059907 16:71559655-71559677 CACACCCATCACACAGCCTCAGG + Intronic
1140479891 16:75256833-75256855 CTGCCCCACCTGCCAGCCCCAGG - Intronic
1141448533 16:84080546-84080568 CACCCGCAGCTGCCACCCTCAGG + Intronic
1141636415 16:85316452-85316474 CACCCACACCTCCCAGCCACTGG + Intergenic
1141924527 16:87159207-87159229 CCCACTCCCCTCCCAGCCTCTGG - Intronic
1142098155 16:88256211-88256233 CTCACCCTCCTGCCAGCCCCGGG + Intergenic
1142134245 16:88444341-88444363 CACACCCTCCTACCCTCCTCAGG + Intergenic
1142136468 16:88453907-88453929 AACACCCTCCTCCCGGCCTCCGG - Intronic
1142198688 16:88750869-88750891 TCCACCCACCCTCCAGCCTCAGG + Intronic
1142246575 16:88972976-88972998 CACACTGACCTCCCTGCCTCTGG + Intronic
1142466189 17:138766-138788 CACACACACCTCCCAGCTGCTGG + Intronic
1142716307 17:1748769-1748791 CTTCCCCACCTCCCAGCCTCAGG - Intronic
1142819360 17:2452939-2452961 CACCTCCACCTCCCAGGCTCAGG + Intronic
1143003419 17:3810527-3810549 CACGCCCAGCTGCCTGCCACGGG + Intergenic
1143053057 17:4142679-4142701 CACACCCCCCTGCGAGTCGCTGG - Exonic
1144325718 17:14177913-14177935 CGCAGCCACCTCACAGCCTCAGG + Intronic
1144474592 17:15574801-15574823 CGCAGCCACCTCACAGCCTCAGG + Intronic
1145121797 17:20267006-20267028 CAGACCCACCTGCCGAGCTCCGG + Intronic
1145203288 17:20966512-20966534 CAGACCCACCTGCCAAGCCCCGG + Intergenic
1145285175 17:21500288-21500310 TAGCCCCACCTGCCAACCTCTGG - Intergenic
1145979335 17:29002556-29002578 CACCCCCACCCACCAGCCCCGGG - Intronic
1146361068 17:32178265-32178287 CACTGCAACCTGCCTGCCTCGGG + Intronic
1146832916 17:36085327-36085349 CACCCCGACCTCCCAGCCCCTGG - Intergenic
1147129106 17:38395624-38395646 CACACACACCTTCCTCCCTCTGG - Intronic
1147138444 17:38448208-38448230 CACCTCCCACTGCCAGCCTCAGG - Intronic
1147284203 17:39388375-39388397 AACCTCCACCTGCCAGGCTCAGG - Intronic
1147317216 17:39626802-39626824 CCCACCCTCCTCCCAGCCCCAGG + Intronic
1147664800 17:42139793-42139815 CACACACACGTCCCAGCCACAGG + Intronic
1147910425 17:43852934-43852956 TTCTCCCACCTTCCAGCCTCTGG + Exonic
1147951911 17:44112253-44112275 ATTACCCACCAGCCAGCCTCAGG + Intronic
1147987472 17:44314892-44314914 CACACCCACCTCCAACCCTGTGG + Intronic
1148104174 17:45110599-45110621 CAGACCCCCCAGCCAGCCCCTGG + Exonic
1148245425 17:46026936-46026958 CACACGAAGCTGCCAGCCCCAGG - Exonic
1148454310 17:47802718-47802740 CCCACCCACCTACCCTCCTCTGG + Intergenic
1148751088 17:49946315-49946337 CTCACACACCTCCCTGCCTCAGG + Intergenic
1149199018 17:54160902-54160924 ACCACTCACGTGCCAGCCTCAGG + Intergenic
1149345624 17:55732128-55732150 CACACCCTCTTGGCAGCCTCAGG - Intergenic
1149453221 17:56766389-56766411 CAAACCTCTCTGCCAGCCTCTGG - Intergenic
1149992533 17:61390950-61390972 CACACACACCGGGCAGTCTCTGG - Intronic
1150336915 17:64337106-64337128 CCAACCCACCTGGAAGCCTCTGG - Intronic
1150692308 17:67377283-67377305 CGCACCCACCTCCCGGCCCCAGG + Intronic
1151081305 17:71332833-71332855 CACACACCCTTCCCAGCCTCTGG - Intergenic
1151275483 17:73030843-73030865 CACAGCCACATGCCAGGCTGCGG + Intronic
1151793378 17:76324771-76324793 CACTGCACCCTGCCAGCCTCAGG - Intronic
1152032977 17:77855140-77855162 CACATCCACCTGCCAGGGACAGG + Intergenic
1152035514 17:77869883-77869905 GCCACACCCCTGCCAGCCTCAGG + Intergenic
1152586117 17:81190232-81190254 CACACCCACCTCTCAGCCTGTGG + Intronic
1152793806 17:82296881-82296903 CCCAACCACCTGCCAGCTGCTGG + Intergenic
1154018810 18:10644548-10644570 CACACTCACCTGGCAGCCTGGGG + Intergenic
1154185418 18:12178874-12178896 CACACTCACCTGGCAGCCTGGGG - Intergenic
1155908500 18:31481624-31481646 CACACCCACATTCTTGCCTCAGG + Intergenic
1157187702 18:45554486-45554508 CACCCCCACCTTGCAGCCCCAGG - Intronic
1157493021 18:48136998-48137020 CAGACCCACCTGGCCGCCCCGGG + Intronic
1157609993 18:48950183-48950205 CATCCCCACCCGCCAGCCGCGGG - Exonic
1158090062 18:53700659-53700681 CTCCCCCACCTCCCAGCCCCTGG + Intergenic
1159358320 18:67365955-67365977 CAGATCCAGATGCCAGCCTCAGG + Intergenic
1159679831 18:71335572-71335594 CACTCCCCCATCCCAGCCTCTGG + Intergenic
1161120592 19:2523667-2523689 CACACCCACCAGCCTCACTCAGG - Intronic
1161977998 19:7616668-7616690 CCCACACACCTCCCAGGCTCTGG - Intronic
1162098522 19:8325156-8325178 CTCACCTCCCTGCAAGCCTCGGG + Intronic
1163148196 19:15396589-15396611 CACTCCCACATGCCAGCCCCCGG + Intronic
1163249690 19:16119136-16119158 CACCCCCACTTGCCAGTTTCAGG + Intronic
1164479640 19:28601554-28601576 CACACCCACCTACCAGGATTAGG + Intergenic
1165405984 19:35631392-35631414 CAGACTCACCTGCCCGCCGCAGG - Exonic
1165792204 19:38499367-38499389 CACAGGCCCCTGCCAGCCCCAGG - Intronic
1166022606 19:40046079-40046101 CACACACCCTTCCCAGCCTCTGG - Intronic
1166269389 19:41704619-41704641 GACACCCACCTGCCGGCCCCAGG + Intronic
1166688562 19:44809859-44809881 CACCCCCACCCCCCAGCCCCCGG - Intronic
1167145668 19:47679908-47679930 CACGCCCACCTCCCAGCTCCTGG + Exonic
1167623270 19:50570150-50570172 CACAGCCACCTGCCACTCCCTGG - Intergenic
1167674264 19:50874778-50874800 CACAGCCACCTGCCAGGGTTGGG - Exonic
1167869747 19:52357951-52357973 CTCACCTTCCTGTCAGCCTCGGG + Intronic
1168510593 19:56970594-56970616 CAGTCCCACCTGCCAGGCACAGG - Intergenic
925023169 2:587765-587787 CAGACCCAGCTGCCTGGCTCAGG + Intergenic
925450067 2:3961585-3961607 CACACACCCTTGCCAGCCTCTGG + Intergenic
925463865 2:4088927-4088949 AACACCCACATTCCAGCCCCCGG - Intergenic
925622497 2:5807547-5807569 CTCAGCAACCTGCCAGCCTCTGG + Intergenic
925928070 2:8685012-8685034 CCCACCCACCTCCGGGCCTCCGG + Intergenic
925976286 2:9144346-9144368 CACACCCATGTTACAGCCTCAGG + Intergenic
926879670 2:17530266-17530288 CACACTCACCTGACAGCATCAGG + Intergenic
927287040 2:21367679-21367701 CACATCCTCCTGCCAGCACCAGG - Intergenic
927514585 2:23664718-23664740 CTCACCCACATGCCAGCCCTGGG - Intronic
927594559 2:24385298-24385320 CCCACCAACCCTCCAGCCTCTGG + Intergenic
928201891 2:29252604-29252626 AACTTCCACCTCCCAGCCTCTGG - Intronic
928926071 2:36580470-36580492 CACACCTTCCAACCAGCCTCAGG + Intronic
929591521 2:43150588-43150610 CCCAGCCACCTCCCATCCTCTGG - Intergenic
929907407 2:46058309-46058331 CACACCACCCATCCAGCCTCTGG + Intronic
929947652 2:46382585-46382607 CACACCCACCTGACACCTTGTGG - Exonic
932215170 2:69961723-69961745 CCCGCCCTCCTGCCAGCATCCGG + Exonic
932336252 2:70932954-70932976 CAGGCCTACCTGCCAGCCACAGG + Exonic
933720582 2:85395034-85395056 CACACCCTCCTCCCTGGCTCTGG - Intronic
934609852 2:95727029-95727051 CTCGCCCACCTCCCAGCCTCTGG - Intergenic
935764616 2:106353507-106353529 CACACACCCTTCCCAGCCTCTGG + Intergenic
936086599 2:109473729-109473751 CACCCACTCCTGCCTGCCTCAGG + Intronic
936543178 2:113368602-113368624 CTCACCCACCTTCCAGCCTCTGG - Intergenic
937043353 2:118837414-118837436 CCCACCCACCTGCCTGCCAAAGG + Intergenic
937857299 2:126681950-126681972 GTCACCCATCTGCCAGGCTCAGG - Intronic
937871304 2:126788196-126788218 CAGCGCCACCTGCGAGCCTCAGG + Intergenic
938260759 2:129893582-129893604 CACTTCCACCTCCCAGGCTCAGG + Intergenic
938390471 2:130901266-130901288 AACGCCCACCTGCCAGGCTCAGG - Intronic
939613268 2:144334572-144334594 CTCACATACCTGCCAGCATCTGG + Intergenic
939681848 2:145145767-145145789 CACATCCACTGGCCTGCCTCAGG - Intergenic
939852685 2:147319543-147319565 GAAACCCAGCTGCCAGCCTGTGG - Intergenic
939989602 2:148864895-148864917 CAAAGCCCCCTGCCTGCCTCAGG - Intergenic
941227402 2:162866436-162866458 CACACCCATGACCCAGCCTCAGG + Intergenic
942423996 2:175839897-175839919 CACACCCCCTTCCCAGCCTCTGG + Intergenic
942876944 2:180811972-180811994 CACACACCCTTCCCAGCCTCTGG + Intergenic
944673486 2:202015745-202015767 CACCCCCAACTCCCAGCCTTTGG - Intergenic
945978207 2:216287043-216287065 CTCATCCACCTTCCATCCTCTGG + Intronic
946085590 2:217168204-217168226 CTCACCCACCTTCCACCTTCAGG - Intergenic
947421810 2:229947845-229947867 CACACCCACCTGTAATCCACAGG - Intronic
947733281 2:232442529-232442551 CAGAACCAGCTGTCAGCCTCTGG + Intergenic
947753633 2:232545521-232545543 CACACCTGCCTCCCACCCTCAGG + Exonic
948309808 2:236976699-236976721 CACACACACCTTCCAGCTTGAGG + Intergenic
948619722 2:239226843-239226865 CGGTCCCACCTGCCAGCCACAGG + Intronic
1169007908 20:2224200-2224222 CACATCCACCTGCCCTCCACTGG - Intergenic
1169054053 20:2605406-2605428 GACAGACACCTGCAAGCCTCAGG - Intronic
1169118532 20:3082460-3082482 CACGCCCACCGGCCAGTCCCCGG - Intergenic
1169180319 20:3560151-3560173 CCCACCAGCCTGCCAGCCTCTGG + Intronic
1169534673 20:6525381-6525403 CACACCACCTTGCCAGCCTGGGG - Intergenic
1170073100 20:12390118-12390140 CATCCCCACCTGCCCACCTCTGG - Intergenic
1170384329 20:15799450-15799472 CACCCACACTTTCCAGCCTCTGG + Intronic
1171064414 20:22000089-22000111 CACACCCCCTTTCCAGCATCTGG - Intergenic
1171231531 20:23490989-23491011 ATCTCCCACTTGCCAGCCTCCGG - Intergenic
1171340337 20:24422392-24422414 CATGCCCACCTGTCAGCCACAGG + Intergenic
1171968541 20:31548961-31548983 CCCTCCCACCTGTCAGCCCCTGG - Intronic
1172307625 20:33892485-33892507 CACGCACACCTTCCAGCCCCAGG + Intergenic
1172792023 20:37512394-37512416 CTCACCTGCCTGCCAGCCTATGG + Intronic
1172875878 20:38164190-38164212 CTCAGCCACCTGCCTCCCTCGGG - Intronic
1173894608 20:46541537-46541559 CAGACCTGCCTGCAAGCCTCCGG - Exonic
1173926940 20:46787768-46787790 CACACTCCCCTGCAAGGCTCTGG + Intergenic
1174644551 20:52074403-52074425 CACACACCCTTCCCAGCCTCTGG - Intronic
1174687334 20:52468476-52468498 CACACTGGCCTCCCAGCCTCAGG - Intergenic
1175262473 20:57683404-57683426 CAGACGCATCTGCCAGCCTGAGG + Intronic
1175806041 20:61829918-61829940 CACACCTGCCTCCCAGCCCCAGG - Intronic
1175814922 20:61878304-61878326 CACAGCCACCTTCCAGCCGGGGG - Intronic
1178054047 21:28779451-28779473 AACACCCTCCTCCCAACCTCTGG - Intergenic
1178253174 21:31024099-31024121 CATCCCCACCTCCCAACCTCAGG - Intergenic
1178576577 21:33797790-33797812 CCCACCACCATGCCAGCCTCTGG + Intronic
1179063703 21:38004407-38004429 CCCAGCTACCTGCCACCCTCTGG - Intronic
1179645181 21:42771230-42771252 ACCACCCACCTGCCAGCTCCCGG + Intronic
1181142533 22:20816972-20816994 CACTGCCACCTGCCTGCCTTTGG - Intronic
1181480207 22:23194005-23194027 CACAACCACCTCCGTGCCTCAGG - Intronic
1181604332 22:23971196-23971218 CACACCCATCTGCAGGCCTGTGG - Intronic
1182108749 22:27707721-27707743 CGAACCCACCTGCCTGCCTTCGG + Intergenic
1182424076 22:30263077-30263099 CAGACCCACCTCCCAGCGCCGGG - Exonic
1183311092 22:37109793-37109815 CGCACCTGCCTGCCAGCCTCTGG - Intergenic
1183578287 22:38706274-38706296 CCCGCCCACCTGCTAGTCTCCGG + Intronic
1183605533 22:38865222-38865244 CCCACCCCCCTGCCCTCCTCAGG - Exonic
1183659564 22:39211066-39211088 CAATCCCCCCTCCCAGCCTCTGG + Intergenic
1183704622 22:39469128-39469150 CCCACCCACCTGCCCCCTTCTGG - Intronic
1184355906 22:43979464-43979486 CTCAGCCACCTGCCACCCACTGG + Intronic
1184477244 22:44728468-44728490 CACACTCAACTGTCACCCTCGGG - Intronic
1184652215 22:45924662-45924684 AGCACCCACCTGCCAGCCTAGGG - Intronic
1184652236 22:45924723-45924745 GGCACCCACCTGCCAGTCTAGGG - Intronic
1184652248 22:45924753-45924775 GGCACCCACCTGCCAGCCTAGGG - Intronic
1184652319 22:45924969-45924991 GGCACCCACCTGCCAGCCTAGGG - Intronic
1184652348 22:45925063-45925085 AGCACCCACCTGCCAGCCTAGGG - Intronic
1184652366 22:45925125-45925147 AGCACCCACCTGCCAGCCTAGGG - Intronic
1184652387 22:45925187-45925209 GGCACCCACCTGCTAGCCTAGGG - Intronic
1184652404 22:45925249-45925271 GGCACCCACCTGCCAGCCTAGGG - Intronic
1184728234 22:46358327-46358349 TCCACCGTCCTGCCAGCCTCAGG + Intergenic
1185272290 22:49935075-49935097 CTCACCCACCTGCCTGCGACGGG + Intergenic
1185332339 22:50257411-50257433 CACACCCCCCTCCCACCCTGAGG + Intronic
950438168 3:12993035-12993057 CTGTCCCACCTGCCAGCCTGAGG - Intronic
950660004 3:14461414-14461436 CCCACCCCCGTGCCAGCCTGAGG + Intronic
953357667 3:42268034-42268056 ACCACCCACATGCCAGACTCTGG - Intergenic
954428738 3:50457996-50458018 CTCAGCCACCTGCCAGGTTCAGG + Intronic
954699078 3:52442240-52442262 CGGACCCACCTGCTAGCCTGTGG - Exonic
955898410 3:63725888-63725910 GCCACCCACCTGCAAGCCACTGG + Intergenic
955913864 3:63886235-63886257 CTCCCCCAACTCCCAGCCTCTGG - Intronic
956706989 3:72007645-72007667 CACACGCCCATGACAGCCTCAGG - Intergenic
956745625 3:72308827-72308849 GACACCCACATCCCTGCCTCTGG - Intergenic
956910402 3:73810161-73810183 TACTCCCACCCGCCACCCTCTGG - Intergenic
957261811 3:77911359-77911381 CACCCCCACTTCCAAGCCTCTGG + Intergenic
958639607 3:96788559-96788581 CACACCACCTTTCCAGCCTCTGG + Intergenic
959053966 3:101550962-101550984 CACTGCAACCTGCCTGCCTCGGG + Intergenic
959570363 3:107876577-107876599 CCCACCCAGCTCCCAGCCCCAGG - Intergenic
959680938 3:109095726-109095748 CAGACCTACCTGTCAGCTTCTGG - Intronic
960013766 3:112862082-112862104 CACATACACTTCCCAGCCTCTGG + Intergenic
961630777 3:128296847-128296869 CACAACCACCTGACTGCCACTGG - Intronic
961817792 3:129560218-129560240 CACACCCCTCTCCCAGCCGCGGG + Intronic
962315763 3:134358591-134358613 CACCTCCACCTGCCTGCCACCGG - Exonic
962893989 3:139697817-139697839 CACACTCCCCTGCCAGAGTCAGG - Intergenic
963247960 3:143080271-143080293 CACATCTACCTGACAGCCACTGG + Intergenic
965863703 3:173178823-173178845 CACATCCACACTCCAGCCTCAGG - Intergenic
965916987 3:173861502-173861524 CACACACACGTGCCAGCTACTGG - Intronic
965979761 3:174673629-174673651 CACACCCCCTTCCCAGCCTTTGG - Intronic
966998560 3:185309402-185309424 CCCTCGCACCTCCCAGCCTCTGG - Intronic
967149613 3:186636676-186636698 CCAAACCACCTGCTAGCCTCAGG - Intronic
967283193 3:187842466-187842488 CATACCCTCGTCCCAGCCTCTGG + Intergenic
967732229 3:192917347-192917369 CTCACCTGCCTGCCAGCCCCAGG + Intronic
967988299 3:195112642-195112664 CACACGCAGCTCCCAGCCCCGGG + Intronic
967988310 3:195112710-195112732 CACACGCAGCTCCCAGCCCCGGG + Intronic
967988320 3:195112784-195112806 CACACGCAGCTCCCAGCCCCAGG + Intronic
968434285 4:576678-576700 CCCACCCGCCTGCCAGCGGCCGG + Intergenic
968436003 4:589714-589736 CACGCCTCCCTTCCAGCCTCAGG + Intergenic
968443101 4:634367-634389 CTCACGCACCTGCCGCCCTCCGG - Intronic
968451498 4:678051-678073 CACACCCACACGCCTGCCCCAGG - Intronic
968480644 4:831627-831649 CAGCCCCACCTGCCCTCCTCAGG - Intergenic
968587063 4:1423952-1423974 CCCACCACCCTTCCAGCCTCTGG + Intergenic
968713773 4:2139346-2139368 CTCCTCCACCTGCCAGCCTTTGG + Intronic
968912556 4:3483534-3483556 CACAGCCCACCGCCAGCCTCGGG - Intronic
968944980 4:3658856-3658878 CACACCCGCCCTCCAGCCTCGGG + Intergenic
969333357 4:6492700-6492722 TGCACCCACATGCCAGGCTCAGG + Intronic
969573051 4:8021427-8021449 TCCTCCCACCTGCCAGCCCCAGG + Intronic
969909550 4:10430869-10430891 CACACACCCTTCCCAGCCTCTGG + Intergenic
971395335 4:26221921-26221943 CTCACCGCCCTGCCAGTCTCTGG - Intronic
972733679 4:41819324-41819346 CACCACCCCCTGCTAGCCTCTGG - Intergenic
973601612 4:52548184-52548206 CACACCCCTCTCCCAGCTTCTGG + Intergenic
973608015 4:52606980-52607002 CACACTCATCTCCCTGCCTCTGG - Intronic
973961749 4:56117474-56117496 CCCAACCTCCTTCCAGCCTCTGG - Intergenic
976107113 4:81630815-81630837 CTTACCCACCAGCCAGCTTCAGG - Intronic
976857996 4:89627686-89627708 CACATCCAACTGCCAGTCTTTGG - Intergenic
977256432 4:94745876-94745898 TCCCCCCACCTGCCAGCCTTTGG - Intergenic
977826920 4:101543562-101543584 CACACACCCTTCCCAGCCTCTGG - Intronic
978845176 4:113264925-113264947 CACTTCCACCTGCCCGGCTCGGG - Exonic
982070251 4:151688057-151688079 CATTCCCACCTGCCTGCCTCCGG + Intronic
983913560 4:173266853-173266875 CACACACCCTTCCCAGCCTCAGG - Intronic
985050293 4:185983968-185983990 CAAAGCGATCTGCCAGCCTCGGG + Intergenic
985277671 4:188254374-188254396 CACGCCCACCTCCAAGACTCTGG + Intergenic
985662173 5:1162682-1162704 CACACCCACCCCCCACCCCCAGG - Intergenic
985665283 5:1178911-1178933 CACCCCCACCTGCCATCCTTGGG + Intergenic
986269493 5:6218480-6218502 CACATTCACCTCCCAGCCTCTGG + Intergenic
986354221 5:6908060-6908082 CACACCCACCTGCCAAGCCCTGG + Intergenic
987026562 5:13932734-13932756 ATCACCCACCTGACTGCCTCTGG - Intronic
988090646 5:26536936-26536958 TACGCCAACCTGCTAGCCTCTGG + Intergenic
988654843 5:33198652-33198674 TCCTCCCACCTCCCAGCCTCTGG + Intergenic
989640239 5:43577110-43577132 CACACACCCCCACCAGCCTCAGG - Intergenic
990023214 5:51154563-51154585 CACACACTCTTTCCAGCCTCTGG - Intergenic
990461047 5:56031449-56031471 CACACACTCTTCCCAGCCTCTGG - Intergenic
990644177 5:57825050-57825072 CACACCCAACTGGCAGCTGCGGG - Intergenic
992006736 5:72485827-72485849 CACTCCCACTCTCCAGCCTCTGG + Intronic
992940249 5:81753394-81753416 GACACCCTCCTGCCTGCCCCTGG + Intergenic
993531710 5:89033418-89033440 CACACACACCCCACAGCCTCTGG + Intergenic
993846254 5:92947415-92947437 CACACACTCTTCCCAGCCTCTGG + Intergenic
994570576 5:101508098-101508120 CACCACACCCTGCCAGCCTCAGG + Intergenic
994821629 5:104658971-104658993 CACACACCCTTCCCAGCCTCTGG - Intergenic
994866398 5:105277362-105277384 CACACACTCTTCCCAGCCTCTGG - Intergenic
997234631 5:132265720-132265742 CATACCCACCTGCCAGTCCAGGG + Intronic
997599843 5:135131720-135131742 CCCTTCCACATGCCAGCCTCAGG - Intronic
998149174 5:139747303-139747325 CCCGCCCACCTGCCAGCCCAGGG - Intergenic
998378848 5:141709685-141709707 CACCCCCAGCTGACAGCCTAAGG - Intergenic
998383955 5:141745450-141745472 CACACCCACCCCCAAGCCCCAGG + Intergenic
999310536 5:150548935-150548957 TGCTCCCACCTGCCTGCCTCAGG - Intronic
999392812 5:151206438-151206460 CACCCCCACCCGACAACCTCTGG - Intronic
999980808 5:156956138-156956160 CTCACCCACCCCCCAGCCTCTGG + Intronic
1000020898 5:157318691-157318713 CACGCCCAACTGCCAGTGTCTGG - Intronic
1001254368 5:170172115-170172137 CACATCCACCTGCCAACTTCAGG - Intergenic
1001651612 5:173319937-173319959 CATGCCCACCTGCCCACCTCAGG - Intronic
1001703560 5:173724691-173724713 CAGCCCCACCTTCCAACCTCGGG - Intergenic
1002101653 5:176860886-176860908 CCTGCCCACCTGCCAGACTCCGG - Intronic
1003066372 6:2906585-2906607 CACACCGGACTGCGAGCCTCAGG + Intergenic
1003118902 6:3304182-3304204 CACACACACCCTCCTGCCTCAGG - Intronic
1003497502 6:6677304-6677326 CACACCTTCCTGCCACCCTGAGG - Intergenic
1003520844 6:6857133-6857155 CACACCCTTCCGCCAGCCCCAGG - Intergenic
1003559069 6:7166161-7166183 CACCCCCAACTGCCAGCCCCTGG + Intronic
1004026696 6:11826390-11826412 AACACACCCTTGCCAGCCTCTGG + Intergenic
1005432643 6:25774647-25774669 CATTCCCAACAGCCAGCCTCAGG - Intronic
1005880209 6:30051807-30051829 CACACACCCTTCCCAGCCTCTGG + Intergenic
1005982119 6:30844494-30844516 CACACCCACCAGCCACACTGTGG + Intergenic
1006367082 6:33621990-33622012 GCCACCCACCTGCCCGCCCCCGG - Intronic
1006422998 6:33947246-33947268 CACAGCACCCTGCCTGCCTCAGG + Intergenic
1006532675 6:34670253-34670275 CATACCCACCCCCCAGCCTTGGG - Intronic
1006670510 6:35727453-35727475 CACACCCACTCGCCAGTGTCTGG + Intronic
1007088374 6:39166646-39166668 CAGAGCCACCTGCCCGTCTCTGG - Intergenic
1007937917 6:45750382-45750404 CAGCCCCACCCACCAGCCTCTGG + Intergenic
1008671437 6:53773165-53773187 CACACCCAGCTTCCTTCCTCAGG + Intergenic
1009522016 6:64694959-64694981 CACTACCACCTGCTAGTCTCTGG + Intronic
1011133490 6:84075246-84075268 CACACCCACCTGACTGCCCAGGG + Intronic
1013783532 6:113754624-113754646 CACACACCCTTCCCAGCCTCTGG - Intergenic
1015017602 6:128433281-128433303 CACACACCCTTCCCAGCCTCTGG + Intronic
1015594615 6:134854482-134854504 CACACACCCTTCCCAGCCTCTGG + Intergenic
1018176846 6:161184574-161184596 CATTCCCACCTGTCATCCTCTGG + Intronic
1018413818 6:163583750-163583772 CACACCCACATTCCCACCTCTGG + Intergenic
1018990035 6:168667584-168667606 CATAACCAGCTGCCACCCTCAGG + Exonic
1019571356 7:1713922-1713944 CACAGCCGCCTGTCACCCTCTGG - Intronic
1019713754 7:2529241-2529263 CTCACCCTCCTGGCAGCCCCGGG + Intergenic
1020014845 7:4824978-4825000 CGCCCCCACCTGCCAACCTGGGG + Intronic
1020856699 7:13435965-13435987 CACCCCCACTTTCTAGCCTCTGG + Intergenic
1020865109 7:13550354-13550376 CCTACCCACCTCACAGCCTCTGG - Intergenic
1021483537 7:21144174-21144196 CAAATCCACTTGCCAGCCTCAGG - Intergenic
1021881975 7:25103980-25104002 CCCACCCACCGGCCAGCCTCTGG + Intergenic
1022194394 7:28049980-28050002 CAGCCGCACCTGCCAGCCTTAGG - Intronic
1022293742 7:29029638-29029660 CATCCCCACTTCCCAGCCTCTGG - Intronic
1022495380 7:30850029-30850051 CATGCCCACCTCCAAGCCTCTGG - Intronic
1022517853 7:30987240-30987262 CACACCCACCTGCCAGCCTCTGG - Intronic
1023929075 7:44693927-44693949 CACACGTACATGACAGCCTCGGG - Exonic
1023971746 7:44996744-44996766 CACACACCCTTCCCAGCCTCTGG - Intergenic
1024000069 7:45184063-45184085 CACACCCCCACTCCAGCCTCTGG - Exonic
1025066483 7:55860364-55860386 CACACACCCTTCCCAGCCTCTGG - Intronic
1026968752 7:74455260-74455282 CACTCCCACCCGCCAGGCCCAGG - Intronic
1029125882 7:98295044-98295066 CACACCGTCCTGACAGCCCCAGG + Intronic
1029551170 7:101237868-101237890 CACCCCCTCCCCCCAGCCTCTGG + Intronic
1029595326 7:101534750-101534772 CACACTCACCTGCAACCCCCAGG - Intronic
1030077223 7:105747212-105747234 CAGCTCCACCTGCCAACCTCTGG + Intronic
1030283733 7:107803678-107803700 CTCACCCAACTCCCAGCCACAGG + Intergenic
1031256991 7:119465564-119465586 CACACCCTTCCACCAGCCTCTGG + Intergenic
1031259427 7:119499250-119499272 TGCCCCTACCTGCCAGCCTCTGG + Intergenic
1031986176 7:128166186-128166208 CAAACCCAGCTGCCCGCCTCAGG - Intergenic
1032020505 7:128405157-128405179 CAGACCCACCCGTCTGCCTCTGG - Intronic
1032319006 7:130867886-130867908 GACACCCAGCTGGCATCCTCTGG + Intergenic
1033753697 7:144379893-144379915 CACGCCCTCCAGCCAGCCTGTGG - Exonic
1034025919 7:147703863-147703885 CACACACCCTTCCCAGCCTCTGG + Intronic
1034460634 7:151196123-151196145 CACACCCCCCCACCATCCTCAGG - Intronic
1034523531 7:151639463-151639485 CTGACCCACATGCCAGTCTCTGG - Intronic
1035199301 7:157250117-157250139 CACACCTCCCGGCCAGTCTCTGG - Intronic
1036470296 8:9046949-9046971 CACAGACCTCTGCCAGCCTCAGG - Intronic
1036794042 8:11742775-11742797 CACACCCAGGCGCCAGCCGCAGG + Intronic
1037560668 8:20071911-20071933 TACAGGCACCTGCAAGCCTCTGG - Intergenic
1037655667 8:20882012-20882034 CAAAGCCACCAGCCAGCCACAGG - Intergenic
1037711729 8:21360540-21360562 GGGACCCACCTGCCAGCCACAGG + Intergenic
1037825042 8:22155862-22155884 CACTCACAACAGCCAGCCTCAGG - Intronic
1038425977 8:27464027-27464049 CACACCCACCTGCCTGAGCCAGG + Intronic
1038997820 8:32945432-32945454 GACACCCACCTGCAGGCCTGGGG - Intergenic
1039968292 8:42299593-42299615 AGAACCCACCTGCCAGCTTCTGG + Intronic
1042421854 8:68600918-68600940 CACACACACTTCCCAGCCTCTGG + Intronic
1044835271 8:96289267-96289289 CAGTCCCACCTTCCATCCTCCGG - Intronic
1045136602 8:99227045-99227067 CACACACTCTTCCCAGCCTCTGG + Intronic
1046461303 8:114540793-114540815 CACACACACATGCCAGCCTTAGG - Intergenic
1048927992 8:139287850-139287872 CACAACCAACTGGCAACCTCAGG + Intergenic
1048967338 8:139624516-139624538 CCCACCCACCTGCCCTCCCCTGG + Intronic
1049064492 8:140302172-140302194 CAGACCCACATCCCAGCCCCGGG + Intronic
1049069761 8:140347270-140347292 CCCAGCCACCTGCCTGCCTCAGG + Intronic
1049073127 8:140372488-140372510 CACACACCCCTGCCAGACTTAGG + Intronic
1049478399 8:142807428-142807450 CAGCCCCACCTTCCAGCCTTGGG - Intergenic
1049564808 8:143332478-143332500 CACCCCCACCTGCCAGAGCCAGG + Intronic
1049565264 8:143334853-143334875 CACGCGCATCTGCCAGCCTCCGG + Exonic
1049592881 8:143470513-143470535 CCCTCACACCTGCCAGCCTGTGG + Intronic
1049612282 8:143561216-143561238 CTCAGCCACCTGCCAGACACAGG - Intronic
1049973379 9:840574-840596 CACACCCACGTGCCCCCCTAAGG - Intergenic
1050438434 9:5633898-5633920 TTCACCCACCTCCCAGCCCCTGG + Intronic
1052218850 9:25996634-25996656 CCCACCTAGCTGCCACCCTCAGG + Intergenic
1053284640 9:36842295-36842317 CACACACACCCGCCTTCCTCTGG - Intronic
1056023264 9:82464022-82464044 CAGCCCCACATCCCAGCCTCTGG + Intergenic
1056805787 9:89727604-89727626 CACACCCCCCTGCCAGCCTGTGG - Intergenic
1057059892 9:91994301-91994323 CACACCCAGCTCCCAGGCGCTGG + Intergenic
1057145210 9:92754205-92754227 CACACCCACTGGCAAACCTCAGG - Intronic
1058533325 9:105928900-105928922 CACACCCACCTCCCAGCCAAGGG - Intergenic
1059712814 9:116885106-116885128 CACACACCCTTTCCAGCCTCTGG - Intronic
1060151254 9:121289741-121289763 CAACCTCACCTGCCTGCCTCCGG - Intronic
1060838736 9:126777876-126777898 CACGCCCACCTCGCAGGCTCAGG + Intergenic
1060874597 9:127073240-127073262 CACACACACTTCCCAGCCTCTGG + Intronic
1060906172 9:127307962-127307984 ATGACCCACCAGCCAGCCTCAGG - Intronic
1061327209 9:129871178-129871200 TACTCCCACCTCCCAGCCCCTGG + Intronic
1061916882 9:133760048-133760070 CACACCTGCCTGCCACCCCCAGG + Intergenic
1062191625 9:135250850-135250872 GACAGCCATCTGACAGCCTCAGG + Intergenic
1062383581 9:136299296-136299318 CACACCCAAATGCCTGCCTGTGG + Intronic
1062436992 9:136550794-136550816 CAGACCCACCTGCCTGTCCCTGG + Intergenic
1062560045 9:137137474-137137496 CCCACGCAGCTGCCAGGCTCTGG + Intergenic
1185449898 X:276381-276403 CACACTCACCTTCCAGCCGCTGG - Intronic
1185471676 X:387326-387348 CTCACACACCTCCCAGCCTCTGG - Intergenic
1185848943 X:3467560-3467582 CACACACCCTTTCCAGCCTCTGG - Intergenic
1185940694 X:4315698-4315720 CACACCCAAGACCCAGCCTCAGG + Intergenic
1186211187 X:7252370-7252392 CACACCTACCTGCTACCTTCCGG + Intronic
1186570577 X:10711056-10711078 CATCCCCACCCCCCAGCCTCAGG + Intronic
1186655940 X:11612264-11612286 TACACCCAACTGCTAGCTTCTGG + Intronic
1188674827 X:32926285-32926307 CACACCCTCCTCCCAGTCTCTGG - Intronic
1189591559 X:42517865-42517887 CACAAGCAGCTGCCACCCTCAGG + Intergenic
1190488141 X:50950946-50950968 CACACACTCTTCCCAGCCTCTGG - Intergenic
1190764486 X:53464708-53464730 AACTCCCACCTCCCAGGCTCAGG + Intergenic
1190862695 X:54358904-54358926 CTCCCCCACCTGCCACCATCAGG - Intergenic
1191129668 X:56994809-56994831 CCGACCCACCTCCCAGCCTCGGG - Exonic
1192724265 X:73731114-73731136 TACACCTACTTGCCAGCCTCTGG + Intergenic
1194639809 X:96390490-96390512 CACACACCCTTCCCAGCCTCTGG + Intergenic
1194682622 X:96872254-96872276 CCCACCCACTTCCCAGCCTCTGG + Intronic
1194806823 X:98339342-98339364 CACACACACTTTCCAACCTCTGG + Intergenic
1195075260 X:101321441-101321463 CACACACCCTTTCCAGCCTCTGG - Intergenic
1195112274 X:101659749-101659771 CACACCCACCTGCCCGAATCTGG + Exonic
1195643836 X:107206571-107206593 GCCCCCCACCTGCCAACCTCCGG - Intergenic
1196716749 X:118819424-118819446 CACACACCCTTCCCAGCCTCTGG + Intergenic
1197228823 X:123981321-123981343 CCCTCCCACCTCCCAGCCCCTGG + Intronic
1197329853 X:125140421-125140443 CACACACCCTTCCCAGCCTCTGG - Intergenic
1197720781 X:129743146-129743168 CCCACCCACCTGCCTGCCCCAGG - Intronic
1197720843 X:129743676-129743698 CACACCCATATCCCAGACTCAGG + Intronic
1197904879 X:131413984-131414006 TCCTCCCACCTGCCACCCTCAGG - Intergenic
1197904911 X:131414399-131414421 CACACACTCTTTCCAGCCTCTGG - Intergenic
1198550367 X:137738674-137738696 CACACACCCTTCCCAGCCTCTGG + Intergenic
1199385193 X:147215538-147215560 CACACCCATTACCCAGCCTCAGG + Intergenic
1199979707 X:152914230-152914252 CACACCCACCTGCCTGCCCAGGG - Intergenic
1201774573 Y:17648997-17649019 CACACAAACCTGACAGCCTAAGG - Intergenic
1201826983 Y:18256992-18257014 CACACAAACCTGACAGCCTAAGG + Intergenic
1202056465 Y:20837578-20837600 CACACACTTCTTCCAGCCTCTGG + Intergenic
1202378286 Y:24257150-24257172 TGCACCCACCTCCCTGCCTCAGG - Intergenic
1202492496 Y:25412971-25412993 TGCACCCACCTCCCTGCCTCAGG + Intergenic