ID: 1022521820

View in Genome Browser
Species Human (GRCh38)
Location 7:31013391-31013413
Sequence AGCCTCACTCCTGCTTTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022521816_1022521820 -6 Left 1022521816 7:31013374-31013396 CCACTCCTTCTGTGTCCAGCCTC No data
Right 1022521820 7:31013391-31013413 AGCCTCACTCCTGCTTTCGGAGG No data
1022521815_1022521820 15 Left 1022521815 7:31013353-31013375 CCTTTTTTAAGGAGATGTTCACC No data
Right 1022521820 7:31013391-31013413 AGCCTCACTCCTGCTTTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022521820 Original CRISPR AGCCTCACTCCTGCTTTCGG AGG Intergenic
No off target data available for this crispr