ID: 1022522736

View in Genome Browser
Species Human (GRCh38)
Location 7:31018476-31018498
Sequence CCTTCTCAAGATCATGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022522729_1022522736 -1 Left 1022522729 7:31018454-31018476 CCTCTGCCCACGTAGGCCCAAGC No data
Right 1022522736 7:31018476-31018498 CCTTCTCAAGATCATGGATGAGG No data
1022522725_1022522736 25 Left 1022522725 7:31018428-31018450 CCTTACTATAGTCCTCATTCCAG No data
Right 1022522736 7:31018476-31018498 CCTTCTCAAGATCATGGATGAGG No data
1022522726_1022522736 13 Left 1022522726 7:31018440-31018462 CCTCATTCCAGCTTCCTCTGCCC No data
Right 1022522736 7:31018476-31018498 CCTTCTCAAGATCATGGATGAGG No data
1022522730_1022522736 -7 Left 1022522730 7:31018460-31018482 CCCACGTAGGCCCAAGCCTTCTC No data
Right 1022522736 7:31018476-31018498 CCTTCTCAAGATCATGGATGAGG No data
1022522727_1022522736 6 Left 1022522727 7:31018447-31018469 CCAGCTTCCTCTGCCCACGTAGG No data
Right 1022522736 7:31018476-31018498 CCTTCTCAAGATCATGGATGAGG No data
1022522731_1022522736 -8 Left 1022522731 7:31018461-31018483 CCACGTAGGCCCAAGCCTTCTCA No data
Right 1022522736 7:31018476-31018498 CCTTCTCAAGATCATGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022522736 Original CRISPR CCTTCTCAAGATCATGGATG AGG Intergenic
No off target data available for this crispr