ID: 1022524743

View in Genome Browser
Species Human (GRCh38)
Location 7:31029661-31029683
Sequence AGGCATTCCCCCATCCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022524735_1022524743 0 Left 1022524735 7:31029638-31029660 CCCCAGGTCCAGAGCAGAGACCC No data
Right 1022524743 7:31029661-31029683 AGGCATTCCCCCATCCAGGTTGG No data
1022524731_1022524743 16 Left 1022524731 7:31029622-31029644 CCTACCTACAGCAGACCCCCAGG No data
Right 1022524743 7:31029661-31029683 AGGCATTCCCCCATCCAGGTTGG No data
1022524734_1022524743 1 Left 1022524734 7:31029637-31029659 CCCCCAGGTCCAGAGCAGAGACC No data
Right 1022524743 7:31029661-31029683 AGGCATTCCCCCATCCAGGTTGG No data
1022524739_1022524743 -8 Left 1022524739 7:31029646-31029668 CCAGAGCAGAGACCCAGGCATTC No data
Right 1022524743 7:31029661-31029683 AGGCATTCCCCCATCCAGGTTGG No data
1022524733_1022524743 12 Left 1022524733 7:31029626-31029648 CCTACAGCAGACCCCCAGGTCCA No data
Right 1022524743 7:31029661-31029683 AGGCATTCCCCCATCCAGGTTGG No data
1022524737_1022524743 -2 Left 1022524737 7:31029640-31029662 CCAGGTCCAGAGCAGAGACCCAG No data
Right 1022524743 7:31029661-31029683 AGGCATTCCCCCATCCAGGTTGG No data
1022524736_1022524743 -1 Left 1022524736 7:31029639-31029661 CCCAGGTCCAGAGCAGAGACCCA No data
Right 1022524743 7:31029661-31029683 AGGCATTCCCCCATCCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022524743 Original CRISPR AGGCATTCCCCCATCCAGGT TGG Intergenic
No off target data available for this crispr