ID: 1022525791

View in Genome Browser
Species Human (GRCh38)
Location 7:31036347-31036369
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1796
Summary {0: 2, 1: 20, 2: 131, 3: 392, 4: 1251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022525791 Original CRISPR ATGAAGAAACAGGCTCAGAA AGG Intergenic
900876168 1:5343969-5343991 ATGAGAAAACAGACTCAGAGAGG - Intergenic
901006359 1:6173550-6173572 ATGAAGAGAGAGGCTCAGTGGGG - Intronic
901669793 1:10849564-10849586 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
901736513 1:11316006-11316028 GGGAAGAAACAGACTCAGAGGGG - Intergenic
901897272 1:12324872-12324894 ATGAGGAAACCAGCTCAGATTGG + Intronic
902134717 1:14295056-14295078 ATGAGGAAACAAACTCAGAGAGG - Intergenic
902212833 1:14915989-14916011 ATGAGGAAACAGACACAGAGAGG - Intronic
902357589 1:15916834-15916856 ATGAAGCAGCAGGCTGAGCATGG + Intronic
902405179 1:16178918-16178940 TTGAAGAAACAGGCTCAGGGAGG - Intergenic
902443752 1:16448425-16448447 ATGGAGGAGCAGGCCCAGAAAGG - Intronic
902567022 1:17318317-17318339 ATGAGAAAACAGGTTCAGAGAGG - Intronic
902599504 1:17531539-17531561 ATGAATAAATAGGCCCAGAGAGG - Intergenic
902619939 1:17644925-17644947 ATGAGGCCACAGGCTCAGAGAGG + Intronic
902651131 1:17838332-17838354 AGGAAGAAACAGGGGCAGAGTGG - Intergenic
902737295 1:18409533-18409555 AGGAAGAAACAGGATCTGAAGGG - Intergenic
902791998 1:18775708-18775730 AGGAGGAGACAGGCTCATAAGGG - Intergenic
902927265 1:19704380-19704402 ACGAGGAAACAGGGTCAGAGAGG + Intronic
903007963 1:20310842-20310864 ATGAGGAAACAGACTCGGAGGGG - Intronic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903037720 1:20504901-20504923 ACAAGGAAACAGGCTCAGAGAGG + Intronic
903221755 1:21873261-21873283 ATGAAGAAACAGGCTCGGACAGG + Intronic
903289439 1:22298665-22298687 GTGAAGAAACAGGTTCAGACAGG + Intergenic
903390745 1:22962055-22962077 AAGGAGACAGAGGCTCAGAAAGG - Intronic
903469204 1:23573758-23573780 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
903549754 1:24149740-24149762 CTGGAGAAACAGACTCAGAGTGG + Intergenic
903610728 1:24610082-24610104 ATCAGGAAACAGGTTCAGCAAGG + Intergenic
903739761 1:25552015-25552037 ATGAAGAAATGGCCTCAGAGAGG + Intronic
903748865 1:25606679-25606701 ATAAGAAAACAGGCTCAGAGTGG + Intergenic
903838566 1:26221968-26221990 AAGATCAAACAGGCTTAGAAAGG - Intergenic
903921164 1:26802117-26802139 ATGAGAAAACAGGCTTAGAGAGG - Intergenic
903992547 1:27283792-27283814 ATGAGCAAACAGGCTCAGACAGG - Intronic
904129470 1:28265049-28265071 ATGAGGAACAAGGCTCAGAGAGG - Intronic
904287053 1:29459607-29459629 ATGAGGAAAAAGGCTTAGAGAGG + Intergenic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
904535519 1:31196939-31196961 ACCAAGAAACAGGCACAGGAAGG - Intronic
904562233 1:31406653-31406675 ATAGAGAAACAGGCCCAGAAAGG + Intergenic
904565289 1:31425028-31425050 ATGAAGAGTAAGGCTCAGAAAGG + Intronic
904597001 1:31653141-31653163 ATGAGGACACAGGCTCAGAGAGG + Intronic
904771879 1:32885562-32885584 ATGAAGAAATGGGCTCAAAGGGG - Intergenic
904790916 1:33020499-33020521 ATAAGGAAACAGCCTCAGAGAGG + Intronic
904792702 1:33035830-33035852 GTTAAAAAACAGGCCCAGAAAGG - Intronic
904846349 1:33420919-33420941 ATGAAGAAACAGGCTCAAAGAGG - Intronic
904849182 1:33444317-33444339 ATGAATAAATAGGCTCAGTGAGG + Intergenic
904880424 1:33692381-33692403 ATGAGGAAACAGCCTAAAAAAGG + Intronic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
905003322 1:34690623-34690645 ATGACGAAACAGGCACAGAGTGG - Intergenic
905093567 1:35449626-35449648 ATGGAGAAACAAACTCAGAGAGG - Intronic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905301875 1:36991133-36991155 ATGAGAAGACAGGCTCAGAGAGG - Intronic
905431989 1:37931359-37931381 ATGGAGCAACAGGCCCAGAGAGG + Intronic
905462442 1:38130487-38130509 AGGAGGAAGCAGGCTCAGAGAGG + Intergenic
905476873 1:38235200-38235222 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
905546338 1:38803197-38803219 ATGGAAAAACAGGCACAGAGAGG - Intergenic
905646388 1:39627309-39627331 ATGGGGAGACAGGCTCAGAGAGG - Intronic
905652927 1:39668521-39668543 ATGGGGAAACAGGCCCAGAAAGG + Intronic
905799258 1:40832894-40832916 AGGAAGACAGAGGCCCAGAAAGG - Intronic
905833900 1:41099742-41099764 ATAAGGAAACGGGCTCAGAAAGG - Intronic
905875529 1:41429727-41429749 ATGTAGAAATGGGTTCAGAAAGG + Intergenic
906006291 1:42474730-42474752 GTGAAGAAGCAGGCTTAGAGAGG - Intronic
906166066 1:43687308-43687330 ATGAAGAAACAGGCACCTAATGG + Intronic
906282465 1:44563674-44563696 ATGGTGAAACAGGTTCAGAGAGG - Intronic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906488657 1:46250518-46250540 ATGAGAAAACAGTCTCAGAAGGG + Intronic
906674216 1:47681517-47681539 ATGAGGAAACTGGCTCAGAAAGG - Intergenic
906689639 1:47784130-47784152 ATGAGGAAACAGGCTCAGTGAGG + Intronic
906750564 1:48255345-48255367 ATGAAGAAACAAACTCAGAGAGG + Intergenic
906808830 1:48805789-48805811 ATGAGGAAACAGGCTGAGAGAGG - Intronic
906839883 1:49125735-49125757 ATGAGAAAAAAGGCTCAGAGAGG + Intronic
907053758 1:51346204-51346226 TTGATGAAACAGGTTCAGAGGGG + Intergenic
907076998 1:51587998-51588020 ATGAGGAAACAGGTTCAGAGAGG - Intronic
907134596 1:52127903-52127925 ATTAGGAAACAGGTTCAGAGAGG - Intergenic
907159381 1:52359641-52359663 TAGGGGAAACAGGCTCAGAAAGG - Intronic
907373319 1:54016854-54016876 ATGACGAAACACACTCAGAGAGG - Intronic
907441080 1:54478825-54478847 AGAAAGAAAAAGGCTCAGATTGG - Intergenic
907511895 1:54967609-54967631 AAGAAGAAACAGGCTCCGAGGGG - Intergenic
907647788 1:56261526-56261548 ATGAGAAAACAGGATCAGAGTGG - Intergenic
907676924 1:56526468-56526490 ATGTATAAACAGGTTCAAAAGGG - Intronic
907747369 1:57226711-57226733 GTGAGGAAACAGGCTGAGAAAGG + Intronic
907782201 1:57577560-57577582 ATAAAGAAACAGGCTCAGAGAGG + Intronic
908028725 1:59977315-59977337 ATGAGGAAATAGGCACAGCATGG + Intergenic
908136732 1:61140767-61140789 AAATACAAACAGGCTCAGAATGG + Intronic
908156673 1:61360414-61360436 AGGGAGACACAGGCTCAGAGAGG - Intronic
908498288 1:64717320-64717342 ATGAAGAAACAGGATGAAAGAGG - Intergenic
908564345 1:65339228-65339250 ATGAAGGAACAGGCACTGAAAGG + Intronic
908775358 1:67634343-67634365 ATAAAGAAACAGATTCAGAGAGG - Intergenic
908797987 1:67850566-67850588 ATGAAGAAAGAGGCTCAGAGAGG - Intergenic
908874673 1:68658858-68658880 ATCAAGAAACAACCTCACAAGGG + Intergenic
909203230 1:72719819-72719841 ATGAAAAAGCAGCCACAGAATGG - Intergenic
909451299 1:75800529-75800551 AAGAAGATACAGGCTTAAAATGG + Intronic
909504542 1:76373286-76373308 ATGAGAAAACAGGCCCAGCAAGG - Intronic
909546228 1:76851321-76851343 CAGAAGAACCAGGCTCAGAAAGG + Intergenic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
909889153 1:80981219-80981241 ATGAAGAAACTGTATCAAAAAGG + Intergenic
909986509 1:82167261-82167283 ATGAAAAAAAAGGCTCAGGCAGG - Intergenic
910262132 1:85303069-85303091 ATGAAGAAACTGGCCAAGCAGGG + Intergenic
910408807 1:86917562-86917584 ATGCAGGAACAGGCTTAGAGAGG + Intronic
910452050 1:87357389-87357411 ATAGAGAAACAGGCCCAGAGAGG - Intergenic
910453217 1:87368220-87368242 ATGAAGAAGTAGGGTCAGAGAGG + Intergenic
910473035 1:87575962-87575984 ATGAGGAAATAGGCTTAGAATGG + Intergenic
910684209 1:89899813-89899835 ACAAAGAAACAAGCTCAGAAAGG - Intronic
911054685 1:93699858-93699880 ATGAGGAAACAGACCCAGAGAGG + Intronic
911061284 1:93750320-93750342 ATGTGGAAACAGCCTCGGAAAGG - Intronic
911069172 1:93818560-93818582 GTGAGGAAACAGGCTCTGAGTGG - Intronic
911153423 1:94617281-94617303 ATGAGGAAATAGGCTTAGAGAGG + Intergenic
911203923 1:95073970-95073992 ATGAGTAAAAAGGTTCAGAAAGG + Intergenic
911253845 1:95611380-95611402 ATTAAAAAACATGCTCATAAGGG + Intergenic
911261579 1:95692991-95693013 ATGAAGAAACAGCTCTAGAATGG - Intergenic
911345888 1:96696458-96696480 ATAAAGACCCAGGTTCAGAAGGG - Intergenic
911582020 1:99644931-99644953 ATGAGGGAACAGGCTCAGAGAGG - Intergenic
912107927 1:106304067-106304089 ATGAAAAAGCAGGTTCAGGAAGG - Intergenic
912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG + Intronic
912460220 1:109825475-109825497 ATGCAGAAACAGGCAGAGAGAGG + Intergenic
912528211 1:110300544-110300566 ATGAAGGAACAGGCATAGAGAGG + Intergenic
912587730 1:110782016-110782038 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
912603115 1:110959298-110959320 ATGAAGAAACAGATTCAAAGAGG - Intronic
912723464 1:112039346-112039368 CTGAGGAAACAAGCTCAGAGAGG - Intergenic
912866460 1:113262184-113262206 GTGAAGAAAGAGGCACTGAAGGG + Intergenic
913040864 1:115021705-115021727 AAATAGAAACAGGCTCAAAATGG - Intergenic
913047588 1:115087702-115087724 ATGAGGAAACAGGCTCAAATTGG - Intronic
913233827 1:116763675-116763697 AGAAGGAAACAGGCTCAGAGAGG + Intronic
913445131 1:118943059-118943081 ATGAAGAAATTGGCTCAGAAAGG - Intronic
913539462 1:119804975-119804997 GTGAGGAAACAGGCTCAGGATGG + Intronic
914445637 1:147748531-147748553 ATGAGGAAACAAGCTCAAAGAGG + Intergenic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
914973441 1:152333211-152333233 ATGAGGAAACAGACCCAGAAAGG - Intergenic
915068769 1:153248097-153248119 ATGAAGATATAGGATCAGAAAGG + Intergenic
915596730 1:156900518-156900540 ATGAGGAAGCAGGCACAGAGAGG - Intronic
915599670 1:156914265-156914287 ATGAGGACACAGGCTCTGAGAGG - Intronic
915710021 1:157886968-157886990 ATGAAGAAACAAACTTATAATGG + Intronic
916692112 1:167200479-167200501 GCGACGAAACAGGCTCAGAGAGG - Intergenic
917013349 1:170500696-170500718 ATACAGAAACAGGTTCAGAAAGG - Intergenic
917347206 1:174040562-174040584 ATGAGGAAACAGGCACAGAAGGG + Intergenic
917470308 1:175320982-175321004 ATGAAGAAACTGGCCCAGAGAGG + Exonic
917791617 1:178502807-178502829 ATGAGGAAACAAGTTCAGAGAGG + Intergenic
917824365 1:178801441-178801463 ATGATGAAACAGGATCAAATGGG - Intronic
917965281 1:180174867-180174889 ATGAAGAAACAGGCTCGGCCAGG + Intronic
918000083 1:180485506-180485528 GTGAAGACAAAGGCTAAGAATGG + Intronic
918001085 1:180496912-180496934 ATGAAGAGAGAAGCTCAGGAGGG + Intronic
918180473 1:182082585-182082607 AAGAGGAAACAGGCACAGAGAGG + Intergenic
918256174 1:182749953-182749975 ATGAAGAAACAGACTAAGAGAGG - Intergenic
918346571 1:183612633-183612655 ACGAAGAAACAGGCTCAGAAAGG + Intergenic
918610097 1:186479745-186479767 ATGAAGAAACAGATTAAGAGAGG + Intergenic
919016093 1:192038460-192038482 ATTAAGAAACAGCCTCCTAATGG - Intergenic
919215296 1:194545702-194545724 GTGAAGAGACAATCTCAGAATGG - Intergenic
919449784 1:197757217-197757239 ACAAAGAAACAGGCTCAGAGTGG + Intronic
919516853 1:198535757-198535779 CTGAGGAAACAGGCACAGCAAGG + Intronic
919561876 1:199131332-199131354 ATGAAGAAACATGCTCAGTGAGG + Intergenic
919598108 1:199589798-199589820 ATGAAGAAACAGTCTAGTAAAGG - Intergenic
919641889 1:200053430-200053452 ATGAAGAAACTGAGGCAGAAGGG + Intronic
919743868 1:200996524-200996546 ATGATGAAACAGGCTCAGAGAGG - Intronic
919765171 1:201122516-201122538 AAGAGGAAACAGGCTCAGAGAGG + Intronic
919766344 1:201129779-201129801 ATGAGGAAACCGGCTCAAAAGGG + Intergenic
919975232 1:202606215-202606237 ATGGGGAAACAGGTTCAGAGAGG + Intronic
920048599 1:203149739-203149761 ATGAGCAAGAAGGCTCAGAATGG + Intronic
920087174 1:203426112-203426134 GTGAAGAAACAGATTCAGAGAGG - Intergenic
920124840 1:203685737-203685759 AAGAAGAAACAGACTCAGGGAGG - Intronic
920365861 1:205448130-205448152 GTGAGGAAACAGGGCCAGAAGGG + Intronic
920697374 1:208191627-208191649 ATGAAGAAACAGGCACAGAGAGG + Intronic
920729394 1:208468634-208468656 ATGAGGAAACAGATTCAGAATGG + Intergenic
920850562 1:209625452-209625474 ATGAGAAAACAGGCACAGACAGG - Intronic
921103525 1:211952455-211952477 ATAAGGAAACAGGCACAGAAAGG + Intronic
921131076 1:212220570-212220592 ATGAGAAAACAGGCACAGAGAGG - Intergenic
921871473 1:220145173-220145195 ATGAAGAAACAAGCAAAGAGAGG - Intronic
922057758 1:222057652-222057674 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
922490396 1:226011969-226011991 GTGTGGAAACAGACTCAGAAAGG + Intergenic
922495181 1:226051581-226051603 ATGAGGAAATAGGCTAAGGAAGG - Intergenic
922504615 1:226119273-226119295 ATAAGGAAACAGTCTCAGAGAGG + Intergenic
922532585 1:226355800-226355822 ATGTGGAAACAGGCTCAGAGAGG - Intergenic
922580900 1:226697204-226697226 ACAAGGAAACAGGTTCAGAAAGG - Intronic
922727750 1:227931493-227931515 AAAAAGAAACTGGATCAGAAAGG - Intronic
922873364 1:228920801-228920823 GTGAAGAAAGAGTTTCAGAATGG - Intergenic
923088256 1:230718233-230718255 AAGAAAGAACAGGCTGAGAATGG - Intergenic
923982964 1:239346538-239346560 ATAAAGAAACAAGCTCAAAGAGG + Intergenic
923985937 1:239382240-239382262 AAGAATAAACAGCCCCAGAAAGG - Intergenic
924074477 1:240319051-240319073 ATGAAAATACAGGCTTAGAAGGG + Intronic
924191797 1:241561206-241561228 ATGAAGAAAGAGGCTTGGACTGG - Intronic
924254420 1:242168547-242168569 ATGAAGTAAGAGGCTCTTAAAGG + Intronic
924354699 1:243159629-243159651 GAGAAGAAACAGGCCCAGAGAGG + Intronic
1063194574 10:3729512-3729534 AAGGAGAAAAGGGCTCAGAATGG - Intergenic
1063604372 10:7509272-7509294 ATGGGCAAACAGGCTCAGAGAGG + Intergenic
1063653403 10:7962987-7963009 ATTAGGAAACAGGCTCAGAGAGG + Intronic
1063939871 10:11117301-11117323 ATGAAGAAAGCAACTCAGAAAGG - Intronic
1064110665 10:12535908-12535930 ATGAGGACACAGGCTCAGAGGGG + Intronic
1064123128 10:12636647-12636669 ATGAGGAAACAGACTGAGAGGGG + Intronic
1064577106 10:16757627-16757649 ATGAAAAAACAGCCTAAGAGAGG + Intronic
1064681307 10:17813101-17813123 ATGAAGCACCAGGCTCAGGGAGG + Intronic
1064794125 10:18992061-18992083 TTGAAGAAACAGGCAAAGAAGGG + Intergenic
1064893354 10:20205806-20205828 ATGAGGAAACAGGCTTAGAAAGG + Intronic
1065155267 10:22863001-22863023 ATGAGGAAACAGGGTCAGAGGGG + Intergenic
1065419853 10:25530952-25530974 CTGAAGGAAGAGGCACAGAATGG - Intronic
1065673176 10:28144523-28144545 ATGCAAAAGCAGCCTCAGAACGG - Intronic
1066379676 10:34890632-34890654 ATGAAGACAGAGGTTCAGAGAGG - Intergenic
1067067963 10:43114244-43114266 ATGGAGACAGAGGCTCAGAGAGG - Intronic
1067070596 10:43128302-43128324 GGGAAGAAACATGCTGAGAATGG + Exonic
1067166440 10:43869549-43869571 ATGAGGAGAGAGGCTCACAATGG - Intergenic
1067264181 10:44722877-44722899 ATGAAGAGACAGCCAAAGAAAGG + Intergenic
1067410760 10:46062402-46062424 ATGAGGAAACAGGTGCAAAAAGG - Intergenic
1067573566 10:47389125-47389147 AGGAGGAAACTGGCTCAGAGAGG + Intergenic
1067661558 10:48239818-48239840 ATGAGGAAACAGATTCAGAGAGG - Intronic
1067694507 10:48524785-48524807 GTGAGGAAACAGTCTCAGAGGGG - Intronic
1067844149 10:49705932-49705954 ATTTAAAAACAGGCTAAGAATGG + Intronic
1068703124 10:60041494-60041516 ATGAGGAAACAGGCCCAAAGTGG - Intronic
1068959865 10:62855735-62855757 AGGAAGAAAGAGGAGCAGAAAGG + Intronic
1069953439 10:72035318-72035340 ACCAGGAAACAGGCTCGGAAGGG - Intergenic
1070261490 10:74860475-74860497 ATGAAGAAACAGGCCAAATAAGG + Intronic
1070294206 10:75145241-75145263 ATGAAGAAATAGACACATAATGG - Intronic
1070297336 10:75173901-75173923 ATGAGGAAACTGGCTTAGAGAGG - Intronic
1070371171 10:75783655-75783677 ACAAAGAAACAGACTCAAAAAGG - Intronic
1070376953 10:75841923-75841945 ATGAAGAAACAGAGACAGAGGGG - Intronic
1070791592 10:79192730-79192752 ATGAGGATGCAGGCTCAGGAAGG + Intronic
1070828818 10:79406441-79406463 GTGAAGAAGCAGGGTCAGCAGGG - Intronic
1071022510 10:81074683-81074705 AGGAAAAAACAGGCTAAAAAGGG - Intergenic
1071178587 10:82956449-82956471 AGGCAGAGGCAGGCTCAGAATGG + Intronic
1071251636 10:83825171-83825193 ATGAACAAATAGGCTGAGACTGG + Intergenic
1071492980 10:86148895-86148917 GTGAGGAAATAGGCTCAGAGAGG - Intronic
1071701119 10:87937654-87937676 ATGATCAAACAGGCACAGGAAGG + Intronic
1071717010 10:88107159-88107181 AAGAGGAAACATGCTCAGATAGG + Intergenic
1072126609 10:92451150-92451172 AGGTGGAAATAGGCTCAGAAAGG - Intergenic
1072197794 10:93131525-93131547 ACAAAGAAACAGATTCAGAATGG - Intergenic
1072268808 10:93755537-93755559 ATGAAGACACAGCCGAAGAAAGG - Intergenic
1072279743 10:93854867-93854889 GTGAAGAAATAGCCTCAGAAAGG - Intergenic
1072785388 10:98276168-98276190 AAGAAGAAAACTGCTCAGAAAGG + Intergenic
1072798879 10:98377964-98377986 ATGAAGAAAGAGGGTAAGGAAGG - Intergenic
1073082300 10:100867929-100867951 ATGAGGAAACGGGCTCAGTGAGG + Intergenic
1073103931 10:101021629-101021651 AAGAAGAAACAGGTTTAGAGAGG - Intronic
1073267312 10:102235488-102235510 ATGAAGAAATGTGCTCAGAGAGG - Intronic
1073540023 10:104310576-104310598 ATAAGGAAACAGGCACTGAAGGG - Exonic
1073911975 10:108356683-108356705 GTGAGGAAACAGGTTCAGATGGG - Intergenic
1074123171 10:110508326-110508348 ATTAAATAACAGGCTGAGAAGGG - Intronic
1074238218 10:111607796-111607818 ATCATGAAACATGCTCAGAGAGG - Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074525250 10:114257496-114257518 ATGAGGGAACAGGCTCAGAGAGG + Intronic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074786182 10:116843523-116843545 GTGAGGAAATGGGCTCAGAAAGG + Intergenic
1074882317 10:117668619-117668641 ATGAGGGAACAGTCTCAGACAGG + Intergenic
1074951284 10:118339453-118339475 ATAAAGAAATACGCTCTGAAAGG - Intronic
1075220078 10:120576977-120576999 AAGAGGAAACTGGCTCACAAGGG - Intronic
1075226973 10:120638381-120638403 TTGAAGAAACAAGCTACGAAGGG + Intergenic
1075334618 10:121599076-121599098 ATAAGGAAACAGGATCAGAGAGG + Intergenic
1075447368 10:122522661-122522683 AGAAAGAAACAAGCTCAGAGAGG + Intergenic
1075654318 10:124151410-124151432 ATGAAGAGAAATGCTCAGATGGG + Intergenic
1075686301 10:124367463-124367485 ATCAGGAAACAGGCTCAGAGAGG + Intergenic
1075733248 10:124648690-124648712 ATGAGCAAACAGGCTCAGAAAGG + Intronic
1076113509 10:127879518-127879540 ATGAGGAATGAGGCTCAGAAAGG - Intronic
1076468011 10:130698340-130698362 AGGATGAAAGAGGCACAGAAAGG + Intergenic
1076557236 10:131334967-131334989 ATGAAGCATCATGCTCTGAAGGG + Intergenic
1077146887 11:1050450-1050472 ATGAGGAAACAGGCACAGAGAGG + Intergenic
1077305236 11:1865968-1865990 AGGAAGAAACAGGCTGGGAGAGG - Intronic
1077475125 11:2783932-2783954 ATGAAAAGACAGCCACAGAATGG - Intronic
1077615760 11:3672327-3672349 GTGAAAAAACAGGCTCAGATGGG - Intronic
1078018078 11:7632550-7632572 CTGAAGAACCAAGATCAGAAAGG + Intronic
1078069558 11:8099369-8099391 ATGAAGAAAAAGGTTCAAAGGGG - Intronic
1078114601 11:8433726-8433748 ATGAAGAATGAGGCTAAGAGAGG - Intronic
1078267496 11:9766017-9766039 ATGAGGAAATAGGCTCAGACAGG + Intergenic
1078655426 11:13234523-13234545 AGGAGAAAACAGGCTCAGAGAGG + Intergenic
1078707441 11:13758758-13758780 ATGAAGAAACAGAATCAAAGAGG + Intergenic
1078713132 11:13814262-13814284 ATGAAGAAAGAGGCCCACGAAGG - Intergenic
1078730245 11:13966813-13966835 ATGGAGAAATTGGCTCAGAGAGG - Intronic
1078735255 11:14013825-14013847 ATGAAGGAAGAGACTCAGAGAGG + Intronic
1078746211 11:14117872-14117894 ATAAGGAAACAGGCTCAGGGAGG - Intronic
1078819750 11:14866043-14866065 ATGAGGAAACTGGCACAGAGAGG - Intronic
1078881964 11:15460355-15460377 ATGAAGAAACAACCTAGGAATGG - Intergenic
1079015338 11:16863855-16863877 ATCAGGAAAGAGGCTTAGAAGGG + Intronic
1079075573 11:17383583-17383605 ATGAGGACACAGGGTCAGAAAGG - Intergenic
1079138889 11:17794448-17794470 ATGAAGAACCAGGCTCAGAGAGG + Intronic
1079139536 11:17798865-17798887 ATGAGGAAACAGGCTGGGAGAGG + Intronic
1079247849 11:18766232-18766254 ATCATTAAACAGGCTCAGAGAGG + Intronic
1079252736 11:18798839-18798861 CTGAAGAACCAGGCTTGGAAAGG + Intergenic
1079307833 11:19339491-19339513 AGGAAGAAACAGCATCAGAGAGG - Intergenic
1079324536 11:19480333-19480355 AGGAGGAAACAGGCTTAGAGAGG + Intronic
1079422633 11:20308312-20308334 ATAAAGAAACAGACAGAGAAAGG + Intergenic
1079449121 11:20584124-20584146 ACCAAGAAATAGTCTCAGAAAGG - Intergenic
1079504248 11:21135566-21135588 ATAAGGAAACAGGCTCAGATGGG - Intronic
1080113397 11:28595168-28595190 ATGAGGAGACAGAATCAGAATGG - Intergenic
1080582788 11:33657485-33657507 ATGAGGAAACAGGCTTGGAAAGG + Intronic
1080595106 11:33766054-33766076 ATGAAGAAACAGGATTAAAGAGG - Intronic
1080691296 11:34560757-34560779 ATGAGGAAACAGACTCAGGCAGG + Intergenic
1080704607 11:34678502-34678524 TAGATAAAACAGGCTCAGAAGGG - Intergenic
1080804033 11:35635578-35635600 ATGGGGAAACAGGCACAGAGTGG + Intergenic
1080929931 11:36799395-36799417 ATGAAGCATCAGGATCAGAATGG - Intergenic
1081207024 11:40288126-40288148 ATAAGCAAACAGGCTCAGAGAGG + Intronic
1081678048 11:44982442-44982464 AGGAAGAAAAAGGCTCTGGACGG - Intergenic
1081715015 11:45243974-45243996 ATGAGGAAAGGGGCACAGAAAGG + Exonic
1081745321 11:45468768-45468790 ATGAGGAAACAGCCACAGAGAGG + Intergenic
1082007103 11:47425551-47425573 ATGAGGAGACAGGCCCAGAGAGG - Intronic
1082015709 11:47485074-47485096 ATGAGGAAACAGGCACAGAATGG - Intronic
1082078050 11:47989899-47989921 ATGAAGAGCAAGGATCAGAAAGG - Intronic
1082092030 11:48098017-48098039 TTGAGGAAAAAGGCCCAGAAAGG - Intronic
1082288505 11:50342432-50342454 ATGATGAAGCAAGCTCAGAGAGG + Intergenic
1082740065 11:56901008-56901030 ATGAAGAAACAGACTCACAAAGG + Intergenic
1082792981 11:57359982-57360004 ATGGAAAAACAGACTCAGAGAGG + Intronic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083192115 11:61059693-61059715 ATGTACAAACAGACCCAGAAAGG - Intergenic
1083233598 11:61338297-61338319 ATGTAGAAACAGATTCAGAGAGG - Intronic
1083423791 11:62572246-62572268 GTGAAGAAACATGCTAAGAATGG - Intronic
1083430226 11:62610613-62610635 GTGAGGAAGCAGGCTCAGAGAGG - Intronic
1083658184 11:64240309-64240331 TTGAGGAAATAGGCTCAGAAAGG + Intergenic
1083774862 11:64889448-64889470 AGGAGGACACAGGCTCAGAGAGG - Intergenic
1083793993 11:65003982-65004004 ATGAGGAAACAGGTCCAGAGAGG - Intergenic
1083902029 11:65647799-65647821 AGGAAGAGACAGGCTCAGACGGG - Intronic
1083935801 11:65869527-65869549 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1084041234 11:66543828-66543850 ATGAAGCAGCAGGCACAGGAAGG + Exonic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084180902 11:67445344-67445366 TTGAGGAAACAGGCACAGAGAGG + Intergenic
1084192811 11:67506466-67506488 CTGAAGAACCAGACCCAGAAAGG + Intergenic
1084199172 11:67543799-67543821 AAAAAGAAACAGGCCCAGAGAGG - Intergenic
1084201856 11:67564637-67564659 ATCAAGAAACAAGCTAAGACCGG + Intergenic
1084285110 11:68126011-68126033 ATGAGGAAAGTGGCTTAGAAAGG - Intergenic
1084322888 11:68383541-68383563 ATGAGGAGACAGGCCCAGAGAGG + Intronic
1084392406 11:68886448-68886470 TTGGAGAAACAGACTCAAAAAGG - Intergenic
1084775597 11:71372616-71372638 AAGAAGAAACAGGCCCTGGAGGG + Intergenic
1084881211 11:72172891-72172913 ATGAGGAAATAGGCCCAGAGAGG + Intergenic
1084912354 11:72401037-72401059 ATGAAGAAACAGGCTGTCCATGG + Intronic
1084965522 11:72742408-72742430 ATTAGGAAACAGCCTCAGAGAGG + Intronic
1085021807 11:73214729-73214751 GTAGAGAAACAGGTTCAGAAAGG - Intergenic
1085025757 11:73235631-73235653 ATGGAGAAACAGGCCCAGAGAGG + Exonic
1085039254 11:73317375-73317397 ATAAAGAAGCAGGCTCAGAGTGG + Intronic
1085114120 11:73915110-73915132 ATGAGGAAGCAGGCTCAGAGAGG - Intronic
1085148463 11:74226290-74226312 ATGAGGAAACTGGCTCATATAGG + Intronic
1085193019 11:74645571-74645593 ATGAGGAAACAAGTTCAGAGAGG - Intronic
1085218154 11:74850182-74850204 ATGAAGCAACAGACTCAGAGAGG - Intronic
1085392286 11:76188675-76188697 ATGGGGAAACAGACACAGAAGGG + Intronic
1085419190 11:76341080-76341102 ATGAGGAGACAGGCCCAGAGAGG + Intergenic
1085465911 11:76723225-76723247 ATAAGGAGACAGGCACAGAAAGG + Intergenic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1085557719 11:77440503-77440525 ATGAGGAAACAAACTGAGAAAGG + Intronic
1085604306 11:77883463-77883485 ATAAGGAAAAAGACTCAGAAAGG + Intronic
1085713367 11:78850844-78850866 AAGAAGAATGAGGCTCAGAGAGG + Intronic
1085884696 11:80507939-80507961 ATTAAGAAACTCGCTCAAAATGG + Intergenic
1085896821 11:80649422-80649444 GTGATGAGAGAGGCTCAGAAAGG + Intergenic
1086164053 11:83757162-83757184 AAGAAAAATGAGGCTCAGAAAGG + Intronic
1086286689 11:85259685-85259707 ATGGAGAGACAGGTTCAGATGGG - Intronic
1086327140 11:85713642-85713664 ATGAAGAAAGAGCCGCAGAGAGG - Intronic
1086369744 11:86144471-86144493 ATGAGAAAACTGGTTCAGAAAGG + Intergenic
1086506848 11:87514069-87514091 AGGAAGAGACAGGGTTAGAATGG - Intergenic
1087104552 11:94396843-94396865 ATGAGGAAACAGATTCAGAGAGG - Intronic
1087152807 11:94873590-94873612 ATGAGGAAATGGGCTCAGAAAGG + Exonic
1087176238 11:95098770-95098792 AGGAGGAAACAGGCCCAGAGAGG + Intronic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087321132 11:96660235-96660257 TTAAAGAAACAGACTCAGCAAGG - Intergenic
1087838985 11:102903421-102903443 AGGAGGAAACAGGCACAGAGAGG - Intergenic
1087854595 11:103076585-103076607 ATGAGGAAACAGGCTGAAAACGG - Intronic
1087895982 11:103586866-103586888 GTGAAGAAACAGACTCAAAGAGG + Intergenic
1087948142 11:104190113-104190135 ACACAGAAACAGGCTTAGAATGG - Intergenic
1088191039 11:107228427-107228449 GTGAAGAGATAGGCTGAGAAGGG - Intergenic
1088392162 11:109326492-109326514 ATGAAGAAACAGTCCCAGAAAGG - Intergenic
1088718812 11:112573935-112573957 ATGAGAAAACAGTCTCAGACAGG - Intergenic
1089076279 11:115741370-115741392 ATGAATAAACAGCCTCGAAAGGG + Intergenic
1089151000 11:116364189-116364211 AGAAAAAAACAGCCTCAGAAAGG + Intergenic
1089192436 11:116662702-116662724 TTGAAGAAACAGTCTCAGAGAGG - Intergenic
1089338222 11:117740249-117740271 ATGAGAAAACAGGCTTAGAGAGG + Intronic
1089399322 11:118155353-118155375 ATGAAGAAAGAGGCTCAGAGAGG + Intergenic
1089710217 11:120309231-120309253 ATGACAAGACAGGCTCAGAAAGG + Intronic
1089784411 11:120897810-120897832 ATGAGAAAACATGCTCAGAGAGG + Intronic
1089816988 11:121184621-121184643 CAGATGAAACAGGCTCAGAGAGG + Intronic
1089854743 11:121533301-121533323 ATGAGAAAACAGGCTCAGCAAGG + Intronic
1089929512 11:122296105-122296127 ATGAAGAAATAGGTTCAGAGAGG - Intergenic
1090024423 11:123155529-123155551 ATGGAGAAACCAGCTCAGAGGGG + Intronic
1090279870 11:125446369-125446391 ATGAAGAAACAAGCATGGAAAGG - Intronic
1090411862 11:126514685-126514707 AGAAAGAAACAGGCACAGAGTGG + Intronic
1090452420 11:126818444-126818466 GTGAGGAAATAGGCTCAGAGAGG - Intronic
1090581564 11:128165838-128165860 ATGAAGAAAAAGGAGAAGAAAGG - Intergenic
1090978500 11:131695817-131695839 TTGAGGAAAGAGGCTCAGAGAGG + Intronic
1091064123 11:132492555-132492577 AGGAAGAAACAGGTTGAGAAGGG + Intronic
1091364773 11:135008645-135008667 ATGAAGAATCATCCACAGAATGG + Intergenic
1091371900 11:135067619-135067641 ATAAGGAAACAGACTCTGAAAGG + Intergenic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091538316 12:1434811-1434833 ATGACGAAAGAGGCTCAGCATGG - Intronic
1091676658 12:2495933-2495955 AGGAAGAAACAGCCGTAGAAAGG - Intronic
1091854424 12:3727939-3727961 ATGAGGAAACAGGCCCAAGAGGG + Intronic
1091998652 12:5015651-5015673 ATGAGAAAACAGGCACAGAAAGG - Intergenic
1092141096 12:6183942-6183964 ATGAGGAGGCAGGCTCAGAGAGG + Intergenic
1092145554 12:6212252-6212274 ATGAAGAAACAGGCTCCGAGAGG - Intronic
1092158932 12:6304646-6304668 GGGAGGAAACAGGCTCAGAGAGG - Intergenic
1092248141 12:6874942-6874964 AGGAAGAAACAGGCACAGGGAGG - Intronic
1092302593 12:7266317-7266339 ATGAGGAAACAAGCTCTGAGAGG - Intergenic
1092733829 12:11560114-11560136 ATGAAGAAACAAGACCAGAGAGG + Intergenic
1092974411 12:13730497-13730519 ATGAAGAAGCAAGCCCAGACAGG + Intronic
1092986511 12:13850880-13850902 ATGAAGAAAGAGAATCAGAAAGG - Intronic
1093004546 12:14036817-14036839 AGGAAGAAACAGCCCCAAAAAGG + Intergenic
1093364614 12:18277658-18277680 AAGAACAAACATTCTCAGAAAGG + Intronic
1093365623 12:18293253-18293275 ATGAAGAAACTAGGTCAAAAAGG + Intronic
1093483635 12:19629778-19629800 ATGAAGAAACAATCTCAGGGAGG + Intronic
1093707393 12:22289330-22289352 CTGAGGAAACAGGCTTAGAGCGG + Intronic
1093936900 12:25011111-25011133 ATAAAGAAACAGGTTCAGAGAGG + Intergenic
1094264161 12:28536575-28536597 AAGAACAAACTGGCCCAGAAAGG - Intronic
1094279569 12:28720645-28720667 ATGAAGAAACATGATCAGACTGG + Intergenic
1094341446 12:29416363-29416385 ATGAAGAGACAAGCTAAGACTGG + Intronic
1094381217 12:29845297-29845319 ATGAAGAAACTGAAACAGAAAGG + Intergenic
1094461426 12:30700582-30700604 ATGAGGAAACAGGCACAGAGAGG - Intergenic
1094489902 12:30953435-30953457 ATGAGGAAGCAGGCCCAGACAGG - Intronic
1094528566 12:31250395-31250417 GTCAAGAAACAGTCTCAGAAAGG - Intergenic
1094697691 12:32837351-32837373 ATGAGGAAACAGCCTCAGAGAGG - Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095129679 12:38524907-38524929 GTGAATAAAAAGGATCAGAAAGG - Intergenic
1095350579 12:41205868-41205890 ATGAAGGAACAGGGGAAGAAGGG - Intronic
1095474015 12:42566567-42566589 ATGAAGAAACAGGTTCCAAATGG - Intronic
1095537896 12:43273628-43273650 GTGAGGAAAGAGACTCAGAAAGG - Intergenic
1095619329 12:44230169-44230191 ATAAGGAAACAGGCTTAGAGTGG + Intronic
1095704995 12:45227477-45227499 CTGAAGAAACAGGCTCAGAGAGG - Intronic
1095817273 12:46438305-46438327 ATGAGGAAACTGGCTCAGAGAGG + Intergenic
1095900724 12:47325398-47325420 ATGAAGAAAAATGTTCAGAAAGG + Intergenic
1096194198 12:49638770-49638792 ATGAGGAAACAGGGTCAGAAAGG - Exonic
1096403960 12:51329360-51329382 AGGGAAAAACAGGTTCAGAAAGG - Intronic
1096479025 12:51925806-51925828 ATGCAGAAACAGACTTACAAGGG + Intergenic
1096738009 12:53671262-53671284 ATGAGAATACAGGCTTAGAAAGG - Intronic
1096828409 12:54296550-54296572 ATGAAGATACAGGGGCAGGAGGG - Intronic
1097018131 12:56001635-56001657 ATGAGGAAGCAAGTTCAGAACGG + Exonic
1097045066 12:56181482-56181504 AAGAAGAAAAATGCTAAGAAAGG - Exonic
1097238215 12:57554258-57554280 ATGACGAAACAGGCTCAAAGAGG - Intronic
1097290954 12:57914522-57914544 ATGAAGACACAGACTTAGAGGGG + Intergenic
1097442679 12:59630430-59630452 ATGAGGAAACAGCCTCAAAGAGG - Intronic
1097723752 12:63051142-63051164 GTGAGGAAACAGCCTCAGAGAGG + Intergenic
1097880409 12:64681403-64681425 ATGAGGGAACAGGCTCAGAAAGG + Intronic
1097954037 12:65464899-65464921 ATGAAGAAATAGGCACAGAGAGG - Exonic
1097976836 12:65695542-65695564 ATCCAGAAACTGGCTCACAAGGG + Intergenic
1098214560 12:68201606-68201628 ATGACAAAACATGTTCAGAATGG + Exonic
1098448223 12:70589503-70589525 ATGAGAAAACAGGCTCAAAGAGG - Intronic
1098550542 12:71756249-71756271 CAGAAGAAACAGGCACAGACAGG - Intronic
1098862135 12:75722054-75722076 ATATAGAAACAGGCTCGGAAAGG + Intergenic
1099068809 12:78019152-78019174 ATGAACAAACAAGTTCAGAGAGG + Intronic
1099076882 12:78120734-78120756 ATGAGAAAACAGACTCAGAGAGG - Intronic
1099362417 12:81721176-81721198 ATGAAGAAAGGGGTGCAGAAAGG + Intronic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100278074 12:93090336-93090358 TTGAGGAAACAGGTTCAGAGAGG - Intergenic
1100467486 12:94859712-94859734 AGGAAGAAAGAGGGTCAGGAAGG - Intergenic
1100491580 12:95084948-95084970 ATGCAGAAAACAGCTCAGAAAGG + Intronic
1100826398 12:98478759-98478781 ATGATGAAACAGGCTTACGAAGG + Intergenic
1100880456 12:99010250-99010272 ATGAAGAAAAAAGCACAGAGCGG - Intronic
1101006777 12:100409014-100409036 TTGAAGAAATAGGTTCAAAAAGG + Intronic
1101041412 12:100759737-100759759 ATGGGGAAACGGGCTCAAAATGG - Intronic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101241114 12:102841100-102841122 ATGAGGAAACAGGCTTGGGAAGG + Intronic
1101314729 12:103618702-103618724 ATGAGGAAACAGGCACAGAGTGG - Intronic
1101320333 12:103668012-103668034 ATAAGGAAACAGGCCCAGACAGG - Intronic
1101448170 12:104753137-104753159 ACGAGGAAACAGGCTGAGACAGG - Intronic
1101541138 12:105666548-105666570 ATGAGGAAACAGACATAGAAAGG + Intergenic
1101593355 12:106141414-106141436 TTGAAGAAACCGTATCAGAAAGG + Intergenic
1101608460 12:106268438-106268460 ATGGAGAAATAGGAACAGAAAGG + Intronic
1101739630 12:107490922-107490944 ATGAGAAAAGAGGCTCAGAGAGG + Intronic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1102041413 12:109803258-109803280 ATGAGGAAACAGGCTTGGAGAGG - Intronic
1102103403 12:110299323-110299345 ATGAAGAAAATAGGTCAGAATGG + Intronic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1102210579 12:111123894-111123916 ATAAGGAAACAGGCTCAGAGGGG + Intronic
1102475771 12:113187153-113187175 ATGAGTAAACTGGCTCAGAGAGG - Intronic
1102481773 12:113228704-113228726 AGGAGGAGACAGGCTCAGAGAGG + Intronic
1102502274 12:113360566-113360588 ATGAGGGAACATGCTCAGAGAGG - Intronic
1102522494 12:113487347-113487369 AAGGAACAACAGGCTCAGAAGGG - Intergenic
1102570555 12:113824736-113824758 TTGAAGAAACAGGCTCAGAGAGG - Intronic
1102766883 12:115441065-115441087 ATGAAGAAATAGGCTTAGAGGGG + Intergenic
1102802888 12:115751930-115751952 GTGAGGAAACAGTCTCAGAGAGG - Intergenic
1103038949 12:117678858-117678880 ATGAGGAGACAGGCCCAGAGAGG - Intronic
1103040105 12:117687914-117687936 CTGGAGACCCAGGCTCAGAAAGG - Intronic
1103181408 12:118915117-118915139 AAGAAGAAACAGGCTCTGAAAGG + Intergenic
1103191751 12:119007634-119007656 ATGAGGAAACAAACTCAGAGAGG + Intronic
1103201000 12:119087896-119087918 ATGAGAAAACAGGCTCAGAGAGG - Intronic
1103335559 12:120186824-120186846 GCAAAGAAACAGGCTCAGAGAGG + Intronic
1103515994 12:121508734-121508756 ATGAGGAAGTAGGCTCAGAGAGG - Intronic
1103719974 12:122968308-122968330 ATGAGAAAACAGGCTCAGATAGG - Intronic
1103744774 12:123115048-123115070 ATGGAGACCCAGCCTCAGAAGGG - Intronic
1103817728 12:123671892-123671914 AGGAAGAAACAAGTTCAGAGAGG + Intronic
1103922209 12:124404925-124404947 AGGAGGAAACAGGCTCAGAGAGG + Intronic
1104243113 12:127010656-127010678 ATGAGAAAACAGGCTTAAAATGG - Intergenic
1104360919 12:128132482-128132504 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1104586396 12:130051405-130051427 ATGAAGACAGAGGCACAGAGAGG + Intergenic
1105257287 13:18752416-18752438 ATGTAGATGCAGGTTCAGAAGGG - Intergenic
1105259958 13:18771778-18771800 ATATAGAAGCAGGTTCAGAAGGG - Intergenic
1105260432 13:18775247-18775269 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105262637 13:18791101-18791123 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105311944 13:19219927-19219949 ATGAAGAAACGTGCTCAGAAAGG - Intergenic
1105363354 13:19741795-19741817 GTGAAGAAACGTGCTCAGAAAGG - Intronic
1106193472 13:27474139-27474161 ATGAAGAAACAGGCCCAGACAGG + Intergenic
1106201253 13:27539090-27539112 AGGAAGGAACAGGCACAGAGGGG + Intergenic
1106301246 13:28468156-28468178 ATGAGGAAACTGGTTCAGAAAGG - Intronic
1106373044 13:29155544-29155566 ATGAAGAGGCAGGCTCAGGATGG + Intronic
1106999782 13:35529156-35529178 ATGAGGACACAGGCTCAGACAGG + Intronic
1107061390 13:36163201-36163223 AAGAGGAAACAGGCGCAAAAAGG + Intergenic
1107130436 13:36888462-36888484 ATAAAGAAACAGCCTGAGACTGG - Intronic
1107837496 13:44423496-44423518 ATTAAGAGAAAGGCACAGAAGGG + Intergenic
1108000784 13:45904105-45904127 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1108084463 13:46770905-46770927 ATAAAGAGGTAGGCTCAGAAAGG - Intergenic
1108379773 13:49844635-49844657 ATGTAGAAACAGGCTCACAGAGG - Intergenic
1108739191 13:53317663-53317685 ATGAGGAAAAAGGCTCAGAGAGG + Intergenic
1109225734 13:59692592-59692614 ACAAGGAAACAGGCCCAGAATGG + Intronic
1109293977 13:60507524-60507546 ATTAAGAAACTCACTCAGAATGG + Intronic
1109313642 13:60724472-60724494 TGGAAGAAACAGCCTCAGGAGGG + Intergenic
1109570251 13:64179222-64179244 TTGAAGAGACAGGCTAAGACAGG + Intergenic
1109990419 13:70047600-70047622 ATGAAAATACTGGCTTAGAAAGG - Intronic
1110235156 13:73210123-73210145 ATAAGGAAACAGGCACAGAGAGG - Intergenic
1110559275 13:76892968-76892990 ATGAAGAAAGAAACTCAAAAAGG + Intergenic
1110667091 13:78129742-78129764 AAAAAGAAAGAGTCTCAGAATGG - Intergenic
1110711656 13:78657088-78657110 ATAAGGAAACAGGCTCAAAAAGG - Intronic
1112008945 13:95277955-95277977 ATGAAGAAACTAGCTCAGATTGG + Intronic
1112035869 13:95496109-95496131 ATGCAGACACAGCCTGAGAAAGG - Intronic
1112461594 13:99607633-99607655 ATGAAAAAACAGGGTCAGAAAGG + Intronic
1112579946 13:100669892-100669914 TTGAGGAAACAGGCCCAGAGAGG - Intronic
1112596208 13:100809547-100809569 AAGAAGAAAAAGGCTTTGAAAGG + Intergenic
1112826362 13:103397155-103397177 ATGGTGAAACAGGCACAGAATGG + Intergenic
1113000708 13:105632417-105632439 AGGAAGAAAAAGCCCCAGAAAGG + Intergenic
1113252067 13:108464460-108464482 ATGAGGTAACAGTCTCAGAAAGG + Intergenic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1114027794 14:18544449-18544471 ATGCAAAACCAGCCTCAGAATGG + Intergenic
1114196535 14:20482078-20482100 ATGAACAAACAAACTCAGAATGG - Intergenic
1114276139 14:21146770-21146792 AAGAAGGAGCAGACTCAGAAAGG + Intergenic
1114508978 14:23240953-23240975 ATGAAGAGACTGGCTCAGAGAGG + Intronic
1114535305 14:23418676-23418698 AGAGGGAAACAGGCTCAGAAAGG + Intronic
1115631173 14:35247044-35247066 ATGATGAAACAGGCTCAGAGAGG + Intronic
1115736037 14:36331009-36331031 ATAAGGAAACAGGCACAGAGAGG - Intergenic
1115976751 14:39005269-39005291 TTCTAGAAACAGGCTCAGGAGGG - Intergenic
1115999464 14:39227545-39227567 ATGAAGCAAGAGGCACAGACAGG - Intergenic
1116059596 14:39905130-39905152 TTGAAGAAACAAGCTGAAAATGG - Intergenic
1116069122 14:40020658-40020680 ATAAAGAAACATGCACAAAATGG + Intergenic
1116539005 14:46074282-46074304 ATGAGGAAACTGCCTCAGAGAGG - Intergenic
1116630585 14:47326373-47326395 GTGAAGAATGAGACTCAGAAAGG + Intronic
1117019094 14:51550822-51550844 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1117215796 14:53550261-53550283 ATGACAAAACAGCCCCAGAATGG - Intergenic
1117470081 14:56035690-56035712 ATGAAAAAGAAAGCTCAGAAAGG - Intergenic
1117642320 14:57813063-57813085 ATGAGGAAACAGGCACAGAGAGG + Intronic
1118506062 14:66413295-66413317 ATAAGGAACCAGGCTCAAAAGGG + Intergenic
1118561214 14:67085571-67085593 CCAAAGAAACAGGCTCAGCATGG - Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1118668423 14:68095992-68096014 AAAAAGAAACAGACTCAGAAAGG + Intronic
1118671405 14:68132009-68132031 AGGAAGAATCAGGCTCAGAAAGG + Intronic
1118735198 14:68696102-68696124 AAGAGGAAACAGGCTGAGAGAGG - Intronic
1118815980 14:69314296-69314318 AAGAAGAAACATGTTCAGAAAGG + Intronic
1119201402 14:72755495-72755517 GTGAGGCAATAGGCTCAGAAAGG - Intronic
1119379015 14:74217063-74217085 ATGAGGAAACAGGCTAGAAAAGG + Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119613807 14:76085132-76085154 ATGAGGAAACAGACTCAGAGAGG + Intergenic
1119614138 14:76087309-76087331 ATTAGAAAACAGGATCAGAAAGG - Intergenic
1119726605 14:76925212-76925234 ATGAAGACACAGCCTCAGAAAGG - Intergenic
1119739921 14:77007746-77007768 AAGAGAAAACAGGCCCAGAAAGG - Intergenic
1119788273 14:77328487-77328509 ATGAGGAAATAGCCCCAGAAAGG + Intronic
1119964749 14:78901861-78901883 ATGAAGCAACAGAGTAAGAAAGG - Intronic
1120174128 14:81275596-81275618 ATGAATAAGCAGGCACAGAGAGG + Intronic
1120187516 14:81409626-81409648 ATAAAGTAACTGGCTCAGAGAGG + Intronic
1120421570 14:84292624-84292646 ATGAAGACACAGGCAGAGACTGG - Intergenic
1120674391 14:87404057-87404079 ATAACGAAATAGGCTCAGAAAGG + Intergenic
1120713102 14:87813569-87813591 TTGAAGAAACAGGTGCAGAGAGG - Intergenic
1120785905 14:88535485-88535507 ATTAAGAAACAGACTCAGTGAGG - Intronic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121181727 14:91934280-91934302 ATGAGAAAACAGGCTCAGTGAGG - Intronic
1121246121 14:92462048-92462070 AGGCGGAAACAGGCTCAGAGAGG + Intronic
1121495480 14:94389047-94389069 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1121572897 14:94960929-94960951 ATGAGAAAACAGGCACAGAGAGG - Intergenic
1121576041 14:94988709-94988731 AAGAGGAAACAGACTCAGAGAGG - Intergenic
1121645542 14:95515485-95515507 AAGCAGAAACAGGCCCAGAGAGG - Intergenic
1121744892 14:96280342-96280364 ATGAGGAGACAGGTTCAGAGAGG - Intergenic
1121748061 14:96318341-96318363 CTGAAGAAACTGTCTCATAAAGG + Intronic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1122764424 14:104055528-104055550 ATGAAGAAAGGAGCTCCGAAAGG - Intergenic
1123101857 14:105808868-105808890 AGGAAGAAAAAGGCTAAGGAAGG - Intergenic
1123252979 15:17496388-17496410 ATGAAGAAGTTTGCTCAGAATGG - Intergenic
1123453810 15:20397495-20397517 GTGAAAAAATAGGCTCAAAAAGG + Intergenic
1123722706 15:23073873-23073895 ATGAGGACACAGGCTCACAGAGG - Intergenic
1124444475 15:29717659-29717681 GTGAGGAAACAGACTCAGATTGG - Intronic
1124490891 15:30154559-30154581 ATGGGGAAACAGGTTCAGAGAGG + Intergenic
1124625867 15:31307199-31307221 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1124713823 15:32038881-32038903 AGAAAGCAACAGGCCCAGAAGGG - Intronic
1124752642 15:32383772-32383794 ATGGGGAAACAGGTTCAGAGAGG - Intergenic
1124840183 15:33234352-33234374 CAGAAGAAACAGGCAAAGAAAGG + Intergenic
1125333966 15:38609440-38609462 ATGTAGAATCAGGCTAATAATGG - Intergenic
1125421054 15:39504437-39504459 AGGAAGAAACAGGCACACAAAGG + Intergenic
1125430359 15:39587676-39587698 ATGAGGAAAGAGCCTCAGAGAGG - Intronic
1125553309 15:40564325-40564347 ATGAAAAAACAAGTTCAGAAGGG + Intronic
1125588840 15:40842262-40842284 ATGAGCAAACAGGCTCAGACAGG - Intergenic
1126109221 15:45166043-45166065 ATGAGAAAACAGGCCCAGAGAGG - Intergenic
1126136136 15:45393915-45393937 TTTAAGAATCAGGCTCAGAAAGG + Intronic
1126145929 15:45472924-45472946 CTGAAGAAAAAGGCTTAGAGAGG + Intergenic
1126209019 15:46078656-46078678 ATGAAGAAACAGGTGCCGAGGGG + Intergenic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1126408083 15:48343591-48343613 ATGCAGAAATGGGCTCAGAGAGG + Intergenic
1126499714 15:49332029-49332051 ATGAGGAAACAGGCTGAGATAGG + Intronic
1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG + Intergenic
1126772207 15:52069706-52069728 ATGAAGAAACAGGCTTGGACTGG - Intergenic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1126943075 15:53786900-53786922 ATAAGGAAACAGGCTCACAGAGG + Intergenic
1126953498 15:53909429-53909451 ATGAGGAGACAGGCTCAAGAAGG + Intergenic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127317036 15:57806814-57806836 AAGGAGAAACAGACTCATAAAGG - Intergenic
1127473643 15:59312438-59312460 ATGAAGAAACAGAAGCATAAAGG + Intronic
1127764149 15:62168300-62168322 ATGCAGAAACAGGCTCACAAAGG + Intergenic
1128142474 15:65311936-65311958 ATGATGAAATAGGCTCTGAGTGG - Intergenic
1128252489 15:66172802-66172824 ATGAGGAAACAGGCTCAGACAGG + Intronic
1128323932 15:66711400-66711422 CTGAGGAAACAGGCTCAGAGAGG + Intronic
1128325964 15:66724512-66724534 AAGAAGTAACAGGCTCAGAGAGG + Intronic
1128451707 15:67809699-67809721 ATGAGGAAACAGACTCAGACAGG - Intergenic
1128485729 15:68085648-68085670 ATGAGGAGACAAGTTCAGAAAGG - Intronic
1128501062 15:68228064-68228086 ATGAGGAAATAGGCTTAGATGGG - Intronic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1128643036 15:69353909-69353931 CTGAATCAACAGGCTAAGAAGGG + Intronic
1128705869 15:69837095-69837117 ATGGAGACTGAGGCTCAGAAAGG + Intergenic
1128761021 15:70216078-70216100 TTGAAGAAACAGGCCCAGAGAGG + Intergenic
1128937476 15:71759380-71759402 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1129113963 15:73354627-73354649 ATTAGAAAACAGGCTCAGAGAGG - Intronic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1129250438 15:74305888-74305910 ATGAAGAGACAGGATCAGAGAGG - Intronic
1129575731 15:76743075-76743097 ATGAACAAATAGGCTCAGAGAGG + Intronic
1129660428 15:77550063-77550085 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1129687324 15:77694337-77694359 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1129700278 15:77763724-77763746 AGGAGGAGACAGGCTCAGAGAGG + Intronic
1129713380 15:77832944-77832966 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1129748538 15:78042712-78042734 ATGAAGAGGAAGGCACAGAATGG + Intronic
1129817050 15:78564822-78564844 ACGAGGAAACAGGCCCAGAGAGG + Intergenic
1129820873 15:78601071-78601093 AAGAGAAAACAGGCTCAGAGAGG + Intronic
1129852061 15:78798996-78799018 ATGAGGAAACAGGCTCAGAGGGG - Intronic
1129856225 15:78827194-78827216 AGGAGGAAGCAGGCTCAGAGAGG - Intronic
1129901781 15:79157062-79157084 ATGTGGAAACAGCCTCAGAGAGG + Intergenic
1130250942 15:82300091-82300113 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1130264824 15:82390926-82390948 AAGAAGACACAGGATTAGAATGG - Intergenic
1130358465 15:83157436-83157458 ATGAAAAAGCAGGCTCAAAACGG - Exonic
1130507165 15:84555969-84555991 AAGAAGACACAGGATTAGAATGG + Intergenic
1130551894 15:84894796-84894818 ATGAGGAAACAGGCTCAGTGAGG + Intronic
1130637489 15:85638752-85638774 AAAAAAAAACAGGCTCAGAGGGG - Intronic
1130649817 15:85756156-85756178 CTGAGGAAACATGCTCAGCATGG - Intergenic
1130660027 15:85824059-85824081 ATGAAGAAACAGGCTGATGGAGG + Intergenic
1131032561 15:89198655-89198677 AGGAGGGAACAGGCTCAGAGAGG - Exonic
1131118251 15:89807300-89807322 ATGAGGAGAGAGGTTCAGAAGGG - Intronic
1131179979 15:90233172-90233194 ACAATGAAACAGGTTCAGAAAGG - Intronic
1131245731 15:90791132-90791154 ATGCAGAAATAGGGTCTGAAAGG - Intronic
1131254316 15:90851967-90851989 GTGAGGAAACAGGCACAGAGTGG - Intergenic
1131343633 15:91626507-91626529 ATTAAGAAAAAGGCTCACAATGG + Intergenic
1131441493 15:92463139-92463161 ACTAAGAAACATGCTCAGAGGGG - Intronic
1131864010 15:96687533-96687555 ATGAGGAAACAGGCTCAGGGAGG + Intergenic
1132153339 15:99477609-99477631 TTGAAGAAACAGGCTCAGGGAGG + Intergenic
1132259357 15:100408615-100408637 ATGATGAATCAAGCTCAGAAGGG + Intronic
1132427698 15:101733163-101733185 AAGAAGACACAGGATTAGAATGG + Intergenic
1133003758 16:2865793-2865815 ATGAGGAAATTGGCTCAGAGAGG + Intergenic
1133696757 16:8271496-8271518 ATGAGGATACAGGATCAGAGAGG + Intergenic
1133757751 16:8775429-8775451 ATGAGGAATCAGGCACAGAGAGG + Intronic
1133901333 16:9978063-9978085 ATGGAAGAAAAGGCTCAGAAAGG - Intronic
1133964444 16:10520095-10520117 AGGAAGACACTGTCTCAGAAAGG - Intergenic
1133985432 16:10664716-10664738 ATTAGGAAACAGATTCAGAAGGG + Intronic
1134022864 16:10933521-10933543 ATGAGGAAACTGGCCCAGAGAGG - Intronic
1134046495 16:11104742-11104764 ATAAGGAAACAGCCTCTGAAGGG + Intronic
1134072812 16:11271442-11271464 AAGAGGGAACAGGCTCAGAGAGG + Intronic
1134080665 16:11322951-11322973 GTGAAGAGACAGGCACAGAGAGG + Intronic
1134217848 16:12330239-12330261 GTGAGGAAACAGGCACAGAGAGG - Intronic
1134330401 16:13245616-13245638 AAGAAGAAACAGGCTCAAAGAGG + Intergenic
1134572425 16:15302668-15302690 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1134729957 16:16453373-16453395 GTGAAGAAACAGGCTCAGAGAGG + Intergenic
1134779559 16:16883483-16883505 AAGAGGAAACAAGCTCAGAAAGG + Intergenic
1134837586 16:17375066-17375088 AGGCAGACACAGGCTCAGAGAGG + Intronic
1134847800 16:17455245-17455267 ATGAATAAACAGCTCCAGAAAGG - Intronic
1134874724 16:17687756-17687778 CTGAAGATACCAGCTCAGAATGG + Intergenic
1134904875 16:17971757-17971779 AAGCAGAATGAGGCTCAGAAAGG + Intergenic
1134937476 16:18258527-18258549 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1135042996 16:19132295-19132317 AAGATGAAGCAGGCTCAGAGAGG + Intronic
1135074763 16:19383639-19383661 ATGAGAAAACAGGCTCAGAAAGG - Intergenic
1135080916 16:19434852-19434874 TTGAGGAAACAGACTCAGAGGGG + Intronic
1135184463 16:20303279-20303301 AGGAAGAAACATGCTCAGAGAGG - Intergenic
1135245310 16:20851455-20851477 GTGAGGAAACAGGCCCAGAGAGG - Intronic
1135485184 16:22858717-22858739 ATACAGAAACAGACTCAGAGAGG - Intronic
1135523315 16:23194142-23194164 AGGAAGAAAATGGGTCAGAAAGG - Intronic
1135627871 16:24011815-24011837 ATGAAGAAACAGGAACAGAGAGG - Intronic
1135662968 16:24312437-24312459 ATGAGAAAACAGGCACAGAGAGG - Intronic
1135764450 16:25165482-25165504 AGAAAGAAACAGGCACAGAGGGG - Intronic
1135823817 16:25708421-25708443 ATGAAGAAATTGGTTCAGAATGG - Intronic
1135840793 16:25874333-25874355 GTGAAGAAACAGGTCCAGAGGGG + Intronic
1135845210 16:25912526-25912548 ATGAAGAAATAACCTCAGAAAGG - Intronic
1135861337 16:26058795-26058817 ATGCGGAAACAGGCCCAGAGAGG + Intronic
1135886005 16:26308628-26308650 ATGAGAAAAAAGACTCAGAAAGG - Intergenic
1136063452 16:27742614-27742636 AGGAGGAAACAGGCTCAGCAGGG - Intronic
1136071277 16:27788841-27788863 ATGAGGAAACAGGCACAGAAAGG + Exonic
1136176005 16:28517231-28517253 AAGATGAAACAGGCCCAGAGAGG + Intergenic
1136369360 16:29826268-29826290 ATGAGGAAACAGGCACAGGGTGG + Intronic
1136372370 16:29844468-29844490 GTGAACAAACAGGCCCAGAATGG - Intronic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1136410474 16:30073999-30074021 AGGAGGAAACTGGCTCAGAGGGG - Intergenic
1136555405 16:31004805-31004827 ACAAGGAAACAGGCTCAGAGAGG + Intronic
1136686319 16:31996777-31996799 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1136713510 16:32259033-32259055 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136754401 16:32670398-32670420 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1136786932 16:32940306-32940328 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1136813712 16:33199967-33199989 ATGAAAAAACAGTTTCAGGAAGG - Intronic
1136820188 16:33310047-33310069 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136826751 16:33366586-33366608 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136831817 16:33465357-33465379 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136853578 16:33634291-33634313 ATAAGCAAACAGGCTCAGACTGG - Intergenic
1136882841 16:33913483-33913505 AGGAGGAAACAGGCTCAGAGAGG - Intergenic
1137024048 16:35455773-35455795 ATGAGGAAACAGTCTCAGGGAGG + Intergenic
1137380680 16:47996349-47996371 AAGAAAATAGAGGCTCAGAAAGG - Intergenic
1137400043 16:48145967-48145989 GTGAGGAAACAGGCACAGAGAGG - Intronic
1137491708 16:48938488-48938510 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1137794656 16:51205420-51205442 AGGAAGAGACTGGCACAGAAGGG + Intergenic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1137950460 16:52778854-52778876 ATGACAAAACAGACTCAGAAAGG - Intergenic
1137957098 16:52842721-52842743 AAGAAGAAACTGGCTCAAAGAGG + Intergenic
1138005739 16:53335377-53335399 ATGAATAAACAAGCTTAGCAAGG + Intergenic
1138230714 16:55333864-55333886 ATGAGGAAATAGGCTCAGAGAGG + Intergenic
1138251674 16:55506493-55506515 ATGAAGAAACAGACTTAAAGAGG - Exonic
1138454131 16:57111668-57111690 ATGAGGAGACAGGTTCAGAAAGG - Intronic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138498161 16:57421316-57421338 ATGGAGAAATAGGCTCAGGCAGG - Intergenic
1138512051 16:57514581-57514603 ATGAAGAAACTGACACAGAGAGG + Intronic
1138564385 16:57822229-57822251 AGAAGGAAACAGGCTCAGAGAGG - Intronic
1138879035 16:60988468-60988490 ATGAAGAACCAGGCCCGGCACGG + Intergenic
1139278569 16:65750267-65750289 ATGAGGAAACAGGCCCAGCAAGG + Intergenic
1139336348 16:66234416-66234438 TTGAGGAAATAGGCTCAGAGAGG - Intergenic
1139338595 16:66251478-66251500 ATGAAAAAACAGGCTCACACAGG - Intergenic
1139387278 16:66580748-66580770 ATGAGGAAACAGGCTGGGAATGG - Intronic
1139528379 16:67529838-67529860 ATGCAGAAACAGGCCCAGAGAGG + Exonic
1139694488 16:68664034-68664056 CTGAGGAAACAGGCCCAGAGAGG + Intronic
1139779210 16:69336976-69336998 ATGAGGAAATAGGTTCAGAGAGG - Intronic
1139787460 16:69405366-69405388 ATGAGGCAACAGGCTCAAAGAGG + Intronic
1139807411 16:69579849-69579871 AAGAACAAACAGTCACAGAAAGG - Intronic
1139903033 16:70343018-70343040 ATAAAGAAGCAGGCACAGAGAGG + Intronic
1139969908 16:70767742-70767764 ATGAGGAAACAGACCCAGAGAGG - Intronic
1140525747 16:75621454-75621476 ATGAGGAAACAGACCCAGCAAGG - Intronic
1140885373 16:79238127-79238149 AAGAAGGAAGAGCCTCAGAAAGG - Intergenic
1140932928 16:79644406-79644428 TTGAAGATAGATGCTCAGAAAGG - Intergenic
1141560337 16:84863598-84863620 ATGAGGAAGAAGGCTCAGAGAGG - Intronic
1141712557 16:85708383-85708405 GTGAGGACACAGGCTCAGAGAGG + Intronic
1141760171 16:86023031-86023053 ATGAGGAAACAGGCTCAGATAGG + Intergenic
1141768625 16:86075039-86075061 ATGGAGAAACAGGCCCAGGGTGG - Intergenic
1141929832 16:87194971-87194993 ATGAGAAAACAGACTCAGAGAGG + Intronic
1141984775 16:87572646-87572668 ATAAGGAAACAAGCTCAGAGAGG + Intergenic
1141990526 16:87606597-87606619 ATGAAGAAACAAGCTCAGAGAGG - Intronic
1202992288 16_KI270728v1_random:22941-22963 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1203056548 16_KI270728v1_random:930729-930751 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1203089168 16_KI270728v1_random:1201976-1201998 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1203115172 16_KI270728v1_random:1482736-1482758 ATAAGCAAACAGGCTCAGACTGG - Intergenic
1142590674 17:1004355-1004377 AGGAGTAAACAGGCTCAAAAAGG + Exonic
1142765899 17:2064127-2064149 AGAAAGAAACACGCACAGAAAGG + Intronic
1142858618 17:2747976-2747998 ATGAGGAGACAGGCTTAGAAAGG + Intergenic
1143020989 17:3917133-3917155 ATGAGGAAGCAGGCTCGGAGAGG - Intergenic
1143061923 17:4209090-4209112 ATGATGAAACAACCTAAGAAAGG + Intronic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143381197 17:6497507-6497529 ATGAAGATAAAGGGTCAGACTGG + Intronic
1143392379 17:6567314-6567336 ATAAGGAAACAGGCTTAGAAAGG + Intergenic
1143418002 17:6764141-6764163 AAGAAGAAAGAAGCTCAGAGAGG - Intronic
1143554800 17:7653345-7653367 AGGAGGAAACAGGGTCAGCAGGG - Intronic
1143618892 17:8069881-8069903 ATGAGGAAACAGGCACAGAGAGG - Intergenic
1143747575 17:9004978-9005000 ATGAGGAAACAGACACAGAGGGG - Intergenic
1144010399 17:11142926-11142948 ATGAAGAGAAAGGTTTAGAATGG + Intergenic
1144395361 17:14837913-14837935 ATGAAGAAACAGACTAAGTGAGG - Intergenic
1144620653 17:16816385-16816407 GTGAGGAAACAGGTTCAGAGAGG - Intergenic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1144755783 17:17679999-17680021 ATGAGGAAACAGGCGCAGAGTGG - Intergenic
1144822078 17:18082292-18082314 ATGTAGAAACAGGCTCAGAGAGG + Intergenic
1144833943 17:18147177-18147199 GGGAAGAAACAGGTTCAGAGAGG - Intronic
1144845809 17:18218401-18218423 ATGAGAAAACAGGCCCAGAGAGG + Intergenic
1144884987 17:18451762-18451784 GTGAGGAAACAGGTTCAGAGAGG + Intergenic
1144962195 17:19051078-19051100 ATGAAGAAACAGGCCAGGCATGG + Intergenic
1144972966 17:19123442-19123464 ATGAAGAAACAGGCCAGGCATGG - Intergenic
1145008029 17:19348521-19348543 ATGATGAAACAGGGGCAGAGAGG - Intronic
1145008464 17:19352174-19352196 ATGAAAAAACAGGCTAAGTGGGG - Intronic
1145067846 17:19774411-19774433 AGGATGAAACAGGTTCAGAGAGG - Exonic
1145147232 17:20492615-20492637 GTGAGGAAACAGGTTCAGAGAGG - Intergenic
1145225640 17:21125939-21125961 ATGAATAAACTGGCTCTGGAAGG + Intronic
1145269904 17:21399272-21399294 ACGAAGAAATAAGCTCAGAGAGG - Intronic
1145785544 17:27591496-27591518 ATTAAAAATCAGGCCCAGAAAGG - Intronic
1145912637 17:28551579-28551601 ATGAAAAGACATGCTCAGAGAGG + Intronic
1146204294 17:30888663-30888685 GTGAAAAAACAGGCTCAAAAAGG - Intronic
1146287168 17:31581796-31581818 ATGAGGCAACAGGCTCAGCAGGG - Intergenic
1146287527 17:31584287-31584309 TTGAGGAAACAGGGTCAGAGAGG + Intergenic
1146504888 17:33396161-33396183 ATAAAGAAACAGACCCAGAGAGG + Intronic
1146537420 17:33665059-33665081 AAGAAACAAGAGGCTCAGAAAGG + Intronic
1146556212 17:33826562-33826584 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1146610243 17:34298653-34298675 AGGAAGAAAAAGGCTGAGCATGG - Intergenic
1146937414 17:36820903-36820925 ATGAAGAAACTGGTGCAGGAGGG - Intergenic
1147133502 17:38422201-38422223 ATGAGGAAACAGACACAGAGAGG - Intergenic
1147147278 17:38492445-38492467 AGGAGGAAACAGGCTCAGAGAGG + Intronic
1147358041 17:39912749-39912771 ATGAAGAAACAGATTCAAAGAGG - Intronic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1147423846 17:40336055-40336077 AAAAAGAAACATGCTCAGAGAGG - Intronic
1147563222 17:41521499-41521521 ATCAGGAACCAGGCTCAGAGAGG - Exonic
1147563571 17:41523106-41523128 ATCAGGAAATAGGCTCAGAGAGG - Intergenic
1147572039 17:41577285-41577307 ATGAGGAAACAGGTTCACAGAGG - Intergenic
1147773218 17:42882158-42882180 ATGAAGAAATGGGTTCAGATGGG - Intergenic
1147846186 17:43405437-43405459 ATGAAGAAACTGGCTGGGCACGG + Intergenic
1147976746 17:44252371-44252393 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1148049633 17:44763282-44763304 ATGGAGAAACAGGCACAGAGAGG + Intronic
1148355267 17:46971659-46971681 ATGAAGAAACAGGCCTTGGAAGG + Intronic
1149007978 17:51825480-51825502 ATGAAAAAGCAGGCACAGAGAGG + Intronic
1149344767 17:55723600-55723622 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1149376089 17:56045642-56045664 ATGAAGAAAGAGATTCAGAGAGG + Intergenic
1149858874 17:60109971-60109993 ATGTAGAAACAGGCTCCAAGGGG - Intergenic
1149989975 17:61377575-61377597 AGGAAGAAACTGGCCCAGAGAGG - Intronic
1150004598 17:61462231-61462253 ATCATGAAACAGGCTCTGAAAGG - Intronic
1150218030 17:63481032-63481054 ATGAAGAAGCAGGCACAGCCAGG + Intergenic
1150304253 17:64071065-64071087 AAGAAGAAAGAGGCTGAAAAGGG + Intronic
1150453202 17:65286793-65286815 CTGAAGAAACATGCTCAGAGAGG + Intergenic
1150655962 17:67039843-67039865 AGCAAGAAACAGGCTCAGAAAGG + Intergenic
1151040880 17:70859889-70859911 ATGAAGAAACAGTCTCAAGCAGG - Intergenic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151209810 17:72536083-72536105 ATGAAGAAACATGTTCAGAGAGG - Intergenic
1151379475 17:73715522-73715544 ATGCAAAAACAAGATCAGAAAGG + Intergenic
1151395968 17:73823282-73823304 GTGAGAAAACAGGCTCAGAAAGG + Intergenic
1151407919 17:73901498-73901520 GTGAGGAAACTGGGTCAGAAGGG - Intergenic
1151567105 17:74904835-74904857 ATGATTAAACAGACTCAGAGAGG + Intergenic
1151916456 17:77121713-77121735 ATGAGGAAACGGGCTCAGAATGG + Intronic
1152036213 17:77874712-77874734 AAGAGGAAACAGGCTCAGGATGG - Intergenic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152057693 17:78043742-78043764 ATGAAGATAGAGGCTAGGAAGGG - Intronic
1152218381 17:79047580-79047602 ATGGCAAAACAGGCTCAGCAGGG + Exonic
1152270641 17:79322718-79322740 ATGAACACACAGGCCCAGAGGGG - Intronic
1152726521 17:81949350-81949372 ACAAAGAAACAGGCCCAGAGAGG - Intergenic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153247711 18:3089737-3089759 ATGAAGAAATAGGCTTAGGAAGG + Intronic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153300688 18:3589378-3589400 ATGAATAAAAAGGCACAAAAAGG - Intronic
1153323987 18:3799381-3799403 ATGAAGAAACCCCCGCAGAAGGG - Intronic
1153383270 18:4462009-4462031 ATGAAGAAAAAGGTTGTGAATGG - Intergenic
1153923174 18:9809144-9809166 AGGTAAAAACAGGCTCAGGATGG - Intronic
1154052539 18:10974691-10974713 ATGAAGAAACGGGCTCTAGAGGG - Intronic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1154425587 18:14269548-14269570 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154426072 18:14273023-14273045 ATGTAGAAGCAGGTTCAAAAGGG + Intergenic
1154428321 18:14289133-14289155 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428803 18:14292607-14292629 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154431083 18:14308952-14308974 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433279 18:14324789-14324811 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433753 18:14328261-14328283 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154982689 18:21516695-21516717 ATGAAGAAACATGTTCAGGTTGG + Exonic
1155136382 18:22997698-22997720 ATGAAGAAGCAAGAGCAGAAGGG + Exonic
1155153683 18:23141369-23141391 ATCAAGAATCAGGGTAAGAAAGG + Intronic
1155461353 18:26088146-26088168 CTGAATAAACAAGCCCAGAAGGG + Intronic
1156310445 18:35917593-35917615 AAGATGAGACAGGCTCAGAGAGG - Intergenic
1156561340 18:38129114-38129136 AAGAAGAAAGAGGCAAAGAATGG + Intergenic
1156807978 18:41209883-41209905 ATGTAGAAAAAGGCTAACAATGG + Intergenic
1157272199 18:46284430-46284452 ATGAAGAAACTGATTCAGAGAGG - Intergenic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1157866429 18:51190153-51190175 AAGAGAAAACAGGCTCAGAGAGG + Intronic
1157937757 18:51892117-51892139 ATGAAGACAGAGGCACAGATGGG - Intergenic
1158162087 18:54496537-54496559 ATGAGCCAACAGGCTGAGAATGG - Intergenic
1158457448 18:57621009-57621031 GTAAAGAAATAAGCTCAGAAAGG - Intronic
1158488251 18:57887495-57887517 ATGAAGAAACAAGTCCAGAAAGG + Intergenic
1158777010 18:60594969-60594991 ATTAAAAAACAGGCTGAGAGAGG + Intergenic
1158837188 18:61343344-61343366 ATGAAGAAATGGGGTCAAAAAGG + Intronic
1158959496 18:62577342-62577364 CTGAAGCAACAGGCTAAAAAAGG - Exonic
1159598836 18:70409498-70409520 TTGAGGAAACAGGCACAGAGAGG + Intergenic
1159663334 18:71126384-71126406 ATGAAGCAAGAGGCACAGAAAGG + Intergenic
1159816881 18:73085349-73085371 ATGAGGAAACAGACTTAAAAAGG + Intergenic
1159856476 18:73595773-73595795 ATGAAGACGCAGGCTGAGACTGG + Intergenic
1159957170 18:74527017-74527039 AGGAAGGAAGAGGCTCATAATGG - Intergenic
1160468955 18:79109208-79109230 ATGTAGAGAAAGACTCAGAATGG - Intronic
1160578912 18:79872741-79872763 GTGAGGAAACAGGCTCAGAATGG - Intronic
1160928810 19:1560111-1560133 GTGAAGAAACAGGCATAGCAAGG - Intronic
1160947017 19:1648385-1648407 ATGAGGAAACAGGCTGGGAGCGG - Intronic
1161793665 19:6374784-6374806 AGGAAGAAACAGGCTGTGACTGG - Intronic
1161887415 19:7007595-7007617 GTGAGGTAACAGGATCAGAAGGG - Intergenic
1161887794 19:7010309-7010331 GTGAGGTAACAGGATCAGAAGGG + Intergenic
1162464839 19:10833406-10833428 AAGAGGAAACAGGCTCAGATAGG - Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162614551 19:11787102-11787124 ATGAAATAACAGGCTCAAAGAGG - Intergenic
1162738801 19:12762025-12762047 AAGAATAAAAAGGCCCAGAAAGG - Intergenic
1162757627 19:12869729-12869751 ATGAAGAAACAGTCTCGGCCAGG - Intronic
1162875510 19:13618174-13618196 ATGAGGAAACTGGCCCAGAGAGG - Intronic
1163091624 19:15023908-15023930 TTGAGGAAACAGGCACAGAGAGG + Intergenic
1163153092 19:15426142-15426164 CGGAGGAAACAGGCTCAGAGAGG - Intronic
1163288795 19:16365214-16365236 ATTAAGAAACAGGCTGAGGGGGG - Intronic
1163374114 19:16919953-16919975 GTAAGGAAACAGGCTCAGAGAGG + Intronic
1163785187 19:19271295-19271317 AGGAAGAAACAGCCTGAGCAAGG - Intronic
1164145331 19:22509435-22509457 ATGAGGACACAGACTCAGAAAGG + Intronic
1164980656 19:32611321-32611343 ATGAAAACACAGGATAAGAAAGG - Intronic
1165060351 19:33202100-33202122 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1165412992 19:35673704-35673726 ATGAGTAAACAGGCCCAGAAAGG + Intronic
1165828880 19:38720708-38720730 ATGAAGGCACAGGCCCAGAGAGG + Intronic
1166288945 19:41849434-41849456 ATAGAAAAACAGGCTCAGAGAGG - Intronic
1166351738 19:42202050-42202072 ATGGGGAAACAGGCTCAGAGAGG - Intronic
1166366320 19:42280311-42280333 CGCAAGAAACAGGCTCAGAGGGG - Intronic
1166710984 19:44937130-44937152 ATGAAGAAACAGGCCCACACAGG + Intergenic
1166739160 19:45103800-45103822 AGGAGGAAACAGGCTCACAGAGG + Intronic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
1166840606 19:45694785-45694807 ATGAGGAAATGGGCTCAGAGAGG - Intronic
1166860281 19:45806324-45806346 AGAAAGACAGAGGCTCAGAAAGG + Intronic
1166867676 19:45850527-45850549 AAAGGGAAACAGGCTCAGAATGG - Intronic
1167247296 19:48381330-48381352 ATGAGGAAACAGGTTCAGAGGGG - Intergenic
1167262190 19:48464991-48465013 CTGAGGAATCAGGCTCATAAAGG - Exonic
1167831963 19:52030971-52030993 ATGAAGAAAAAGGAACAGAAAGG + Intergenic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168307670 19:55444196-55444218 AGGGAGATACAGGCTGAGAAAGG + Intergenic
1168679380 19:58303116-58303138 AAGAAGAAACAGGCTAGGCAAGG + Intronic
1168724164 19:58571539-58571561 ATGAGGAAACAGGCAAAGAAAGG + Intronic
925702234 2:6650402-6650424 ATGAAAAAAGAGGCTGAGAAGGG + Intergenic
925751153 2:7091289-7091311 GAGAAGATGCAGGCTCAGAAGGG + Intergenic
925810381 2:7694362-7694384 ATGAGAAAACAGGCCCAGGAAGG + Intergenic
926088505 2:10035159-10035181 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
926110662 2:10181224-10181246 ATGAGGAAACAGGCTTAGAGTGG + Intronic
926210727 2:10867703-10867725 AAGAGGAAACAGGCTCAGAGAGG - Intergenic
926412954 2:12624026-12624048 TAGAGGAAAAAGGCTCAGAAAGG - Intergenic
926826995 2:16915332-16915354 TTTAAGTAACAGGCTAAGAAGGG + Intergenic
926986265 2:18627624-18627646 ATGAGGAAGCAGGCTCAAAAGGG - Intergenic
927318860 2:21719619-21719641 GTAAAAAAACATGCTCAGAATGG - Intergenic
928107147 2:28477915-28477937 CTGCAGAAGCAGACTCAGAAGGG - Intronic
928254330 2:29708791-29708813 ATGAGGAAACAGGCCTAGAGAGG - Intronic
928414559 2:31080943-31080965 AGCCAGAAACATGCTCAGAAAGG + Intronic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
928697706 2:33866749-33866771 ATGAGGAAACAGGCATACAAAGG + Intergenic
929033203 2:37667902-37667924 ATGAGAACACAGGCTCAGAAAGG - Intronic
929046770 2:37798192-37798214 GTGGAGAAACAGGCACAGACAGG - Intergenic
929172439 2:38945411-38945433 ATGAAGCAACAAGAACAGAAAGG + Intronic
929429392 2:41874307-41874329 ATGAAGAAACAAACTCAGAGAGG + Intergenic
929736344 2:44554393-44554415 ATGAAAAATGAGGCACAGAAAGG - Intronic
929753447 2:44741489-44741511 ATCAGAAAACAAGCTCAGAAAGG + Intronic
929769803 2:44882080-44882102 ATAAGGAAACAGACTCAGAGAGG - Intergenic
929831800 2:45353052-45353074 ATTAAGAAATATGATCAGAAGGG + Intergenic
929870166 2:45752549-45752571 ATGAGGAAACAGGCTCAGAGAGG - Intronic
929922590 2:46183009-46183031 ATGAGGAAACTGGCTCAGAGAGG - Intronic
930678615 2:54231575-54231597 ATGAGGAAACAAACTCAGAGAGG - Intronic
930687093 2:54321407-54321429 ATAAAGACAGAGGCTCAGAGAGG + Intergenic
931030237 2:58167412-58167434 ATGTAGAAACAGACAGAGAAAGG - Intronic
931144466 2:59502061-59502083 GTAAAGAAACAGGCTCAGAGAGG - Intergenic
931173227 2:59827110-59827132 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
931212311 2:60208837-60208859 ATGAAGAAACTAGCTCAAAGAGG + Intergenic
931215513 2:60238823-60238845 ATCAAGATACAGGCCCAGCATGG - Intergenic
931474023 2:62570194-62570216 ATGAAGAAACTGGCTCTGAGGGG - Intergenic
932605637 2:73163617-73163639 ATGAGGAAACAGACACAGAGAGG + Intergenic
932626050 2:73296652-73296674 ATGAGGAAACAGATTCAAAAAGG + Intergenic
932823830 2:74922790-74922812 ATGAGGAAACAGGCTCAAAAAGG + Intergenic
933542845 2:83670535-83670557 ATGAAGAAAGAAGAACAGAATGG + Intergenic
933588975 2:84210668-84210690 ATGAAGAAACAGGCACAGAGAGG - Intergenic
933650544 2:84846796-84846818 CTGAAGAAACAGTCTCTGAGTGG + Intronic
933651601 2:84854477-84854499 ATAAGAAAACAGACTCAGAAAGG + Intronic
933800189 2:85954351-85954373 ATAAAGAAACAGGCTTGGAGAGG + Intergenic
933973228 2:87487122-87487144 AAAAAGAAACAGGCTATGAAGGG - Intergenic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
935171242 2:100612765-100612787 TTGAGGACAGAGGCTCAGAAAGG + Intergenic
935763352 2:106341953-106341975 ATGAAGAAACAGACTCCGTCAGG - Intergenic
935803450 2:106723260-106723282 AGGAAGAGAGAGGCTCAGGAAGG + Intergenic
936824719 2:116567665-116567687 GTGAAGAAACAGCCACAGAATGG - Intergenic
936920505 2:117684056-117684078 ATAAAGGAACAGGATCAGGATGG - Intergenic
937549181 2:123065662-123065684 ATGAGGAAACAGACCAAGAAAGG - Intergenic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
937962118 2:127468097-127468119 TTGAAGAAGCAGGCTCAGAAAGG - Intronic
938232111 2:129669888-129669910 AGGAAGGAACCGGCTGAGAATGG + Intergenic
938770562 2:134497706-134497728 GTGAAGAAACTTGCTCAGAGAGG + Intronic
939138549 2:138325215-138325237 ATGAAGAACCAGTTACAGAACGG - Intergenic
939396889 2:141642268-141642290 ATGAGGAAACAGATTCAGAGAGG - Intronic
939712155 2:145535840-145535862 AGCAAGAAACAGGCTCTGGAGGG - Intergenic
939807798 2:146794732-146794754 ATGAAGAATAAAGCTCAGAATGG - Intergenic
939880951 2:147630718-147630740 ATGAGGAAACAAGGGCAGAAAGG - Intergenic
941284293 2:163589991-163590013 ATGAGGAAACAAGCGCAGAAAGG + Intergenic
941297097 2:163752854-163752876 ATGATGAAACAAGTTCAGAGAGG - Intergenic
941317086 2:164007140-164007162 AAGAGGAAACAAGCTCAAAAAGG - Intergenic
941473983 2:165925443-165925465 ATAAAGAAACAGCCTTAGTAAGG - Intronic
941530845 2:166668889-166668911 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
941960793 2:171251160-171251182 AAAAAAAAAAAGGCTCAGAAAGG + Intergenic
942010156 2:171753962-171753984 ATGAAGGAATAGGCTTAGAGAGG - Intergenic
942242471 2:173975691-173975713 ATCAAGAAGCAGGCTAAGCATGG + Intergenic
942522249 2:176816744-176816766 ATAAATAAACATTCTCAGAATGG + Intergenic
943269903 2:185786408-185786430 ATGAAGAAAAAGGGGCAAAAAGG - Intronic
943723034 2:191225063-191225085 ATGAGGAAATGGGTTCAGAAAGG - Intergenic
944175471 2:196823860-196823882 ATGAAGACACAGACTCAGAGAGG + Intergenic
944669235 2:201981457-201981479 ATGAAGAAACAGGCACACTGAGG + Intergenic
944669706 2:201984737-201984759 ATTAGGAAACAGGCCCAGCAAGG + Intergenic
944678736 2:202056388-202056410 TTGAAGAAACAGGTACTGAATGG - Intergenic
944711180 2:202336347-202336369 AGGAAGAGACGGGCACAGAAGGG - Intergenic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945036330 2:205707052-205707074 ATGAAGAAAGATGTTTAGAAAGG - Intronic
945464473 2:210151645-210151667 AAGAAGAAACAGACTCAGCATGG - Intronic
945801296 2:214434601-214434623 ATGAGGAAATGGGCTGAGAAAGG - Intronic
945906493 2:215599625-215599647 GTGAAGAAACAGGTTCAGTGGGG - Intergenic
945942962 2:215968127-215968149 ATGAGAAAACAGGCCCAGAGAGG + Intronic
946166457 2:217867052-217867074 ATGAAGAAACAAGCACAGAGAGG - Intronic
946389435 2:219406583-219406605 GTGAGGAAACAGGCTCAGAGAGG + Intergenic
946960575 2:224980798-224980820 AGGAAAATAAAGGCTCAGAAAGG - Intronic
947403677 2:229752959-229752981 ATGAAGAAAGAGGTCAAGAAAGG - Intergenic
947464379 2:230327902-230327924 AAGAAGAAAAAGGCCCAGGATGG + Intronic
947526123 2:230877773-230877795 ATGAGGAAACAGGTGCAGAGAGG + Intronic
947768409 2:232652035-232652057 ATGGAGAAACAGGCCCACCAAGG - Intronic
947835739 2:233173971-233173993 AGGCTGAAACAGGCTCAGGATGG + Intronic
948262537 2:236614830-236614852 ATGAGAAAACAGGCTCACAGAGG - Intergenic
948880891 2:240856616-240856638 ATGCAGCAGCAGGCTCAGCATGG + Intergenic
949081272 2:242101818-242101840 ATAAAGAAACAGGCTGGGCACGG - Intergenic
1168803096 20:656076-656098 ATTAGGAAACAGGCACAGACAGG - Intronic
1168811403 20:706874-706896 ATGAGGAAACAGGCCCAGAGAGG - Intergenic
1168860945 20:1045743-1045765 TTGAGGAAACAGCCTCAGAGAGG + Intergenic
1168862206 20:1053687-1053709 AGGAGGAAACAGGCTGAGGAGGG - Intergenic
1168960937 20:1869210-1869232 ATAAGGAAACAGGCTCAGAGAGG - Intergenic
1168980663 20:2001045-2001067 ATGAAGAAACAGACACTGAGAGG + Intergenic
1169165601 20:3420939-3420961 ATAAGGAAACAGCCTCAGAAAGG + Intergenic
1169294485 20:4381980-4382002 ATGGGAAAACAGGCTGAGAATGG - Intergenic
1169733794 20:8814859-8814881 ATGTAGAAAGAGGCCCAGAGAGG + Intronic
1169801859 20:9518721-9518743 AAGAAGAAACGGGCCCAGAAAGG - Intronic
1170341932 20:15338668-15338690 ATGAAGAAACAGGCCTAGGGGGG + Intronic
1170543261 20:17410196-17410218 ATAAGGAAACAGGCTCAGAAGGG + Intronic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1171040631 20:21759186-21759208 AGAAGGAAACAGGCTCAGCATGG - Intergenic
1171236011 20:23525701-23525723 AGGAGGAAACAGTCACAGAAAGG + Intergenic
1171562532 20:26137845-26137867 ATGAAGAAACAGGCCAGGAGTGG - Intergenic
1171883582 20:30635384-30635406 ATATAGAAGCAGGTTCAGAAGGG - Intergenic
1171989880 20:31687818-31687840 ATAAGGAATCAGGCTCAGAGAGG - Intronic
1172004145 20:31806171-31806193 AGGAAGAAACAGTCTCTGCAAGG - Intergenic
1172009207 20:31836664-31836686 GTGAAAAAACAGGTTCAGAGAGG + Intergenic
1172024062 20:31935983-31936005 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1172063772 20:32205645-32205667 ATGAGGAAACAGGCTAATAATGG - Intronic
1172134967 20:32680727-32680749 ATTAGGAAACAGGCCCAGAGAGG - Intergenic
1172204375 20:33152376-33152398 ATGAGAAAAAAGGCTCAGAGAGG + Intergenic
1172273824 20:33669204-33669226 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1172277733 20:33689255-33689277 AGGAAGGAAGAGGCTCAGAGAGG + Intergenic
1172321224 20:33996504-33996526 TAGAAGAAACAGGCTTAGAGAGG + Intronic
1172374828 20:34430191-34430213 ATGAGAAAACAAGCTTAGAAAGG + Intronic
1172509481 20:35490501-35490523 ATGAGGCAACAGGCTTAGAGAGG + Intronic
1172548786 20:35782783-35782805 GTGAGGAAACAGGCTCATATAGG - Intronic
1172610701 20:36249725-36249747 ATGAGGAAGCAGGCTCAGGAAGG + Intronic
1172646575 20:36473987-36474009 GTGAAGAAACAAGCCCAGAGAGG - Intronic
1172840423 20:37899869-37899891 ATGAGGACATAGGTTCAGAAAGG - Intergenic
1172848945 20:37946885-37946907 TTGAGGAAACAGGCTCAGAGAGG + Intergenic
1172860957 20:38051516-38051538 ATGAGGATACTGGCTCAAAAAGG + Intronic
1172963148 20:38812916-38812938 ATGCAGAAACTGACTCAGTAGGG + Intronic
1173119977 20:40279880-40279902 ATGAGAAAACAGACTCAGAGAGG - Intergenic
1173205103 20:40986633-40986655 ATGAAGAAACAGGGACAAAGGGG - Intergenic
1173364572 20:42373193-42373215 CTGAGGAGACAGGCTCAGAGAGG + Intronic
1173530285 20:43764074-43764096 AGGAAGAAGCAGGCACAAAAGGG + Intergenic
1173541559 20:43856007-43856029 ATGAGGACATAGGCTCAGAGAGG - Intergenic
1173542387 20:43863860-43863882 ATGAGGAAACAAGCTCAGAAAGG - Intergenic
1173609650 20:44357257-44357279 ATGAGGAAATAGGTTCAGAGAGG - Intronic
1173613861 20:44390215-44390237 ATGGAGAAACACGCTCAGAAAGG + Intronic
1173671186 20:44800006-44800028 ATGAGGAAACAGGCTCAGGGAGG + Intronic
1173846449 20:46191631-46191653 ATGAGGAAACGGGCTCAGAGGGG + Intronic
1173852520 20:46227907-46227929 AAGAGGAAACAGACTCAGAGAGG - Intronic
1173868087 20:46325529-46325551 ATGAAGAAACATGCTCAGAGAGG - Intergenic
1173916995 20:46715044-46715066 AGGAAGCAACAGGATCAGGATGG - Intronic
1173934779 20:46851840-46851862 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174053454 20:47783040-47783062 ATGAGGAAACAGGCACAGAGAGG - Intronic
1174145994 20:48453043-48453065 ACGCAGAAACAGGCCCAGAAAGG + Intergenic
1174146119 20:48453818-48453840 ATGAGGAAACAGGCCTAGACAGG - Intergenic
1174265727 20:49330462-49330484 AAGAAGAATGAGGCTCAGACAGG + Intergenic
1174298469 20:49565734-49565756 AGGAGGAAACAGGCTCAGAAAGG - Intronic
1174307280 20:49622649-49622671 ATGAGGAAACATGCTCAGCAAGG - Intergenic
1174362812 20:50039235-50039257 ATGAGGAAACAGGCTTAAAGAGG - Intergenic
1174462686 20:50694010-50694032 AGAAAGAAACAGGCTGAGCATGG + Intergenic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174519768 20:51120445-51120467 ATGAGGAAACAGGCACAGAGTGG + Intergenic
1174674966 20:52344857-52344879 ATGAAGTAACTGGCTGAGACGGG + Intergenic
1174690874 20:52503355-52503377 ATGATGAAACAGACACAGAGAGG + Intergenic
1175129785 20:56780521-56780543 ATGAGGCAACAGTCTCAGAGGGG + Intergenic
1175231154 20:57474184-57474206 GTGAGGAAACAGACTCAGAGAGG + Intergenic
1175477162 20:59284964-59284986 ATGAGGACACTGGCTCAGAAGGG - Intergenic
1175915773 20:62425057-62425079 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1176843280 21:13857483-13857505 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176843768 21:13860968-13860990 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1176846444 21:13880288-13880310 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176848699 21:13896360-13896382 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1177196307 21:17907102-17907124 ATGAAAAAGCAGGCTCAGAGTGG + Intronic
1178027549 21:28485392-28485414 TTGAAGAAACTTTCTCAGAAAGG + Intergenic
1178028108 21:28491508-28491530 TTTAAGAAAAAGGCTAAGAACGG + Intergenic
1178048579 21:28723645-28723667 ATGAAGAAACAAGCTCCAAGAGG - Intergenic
1178102741 21:29287408-29287430 GTGAAGAAACAGGCACAAATGGG + Intronic
1178376051 21:32068262-32068284 ATGAAGAAACTGGTGCAGAGAGG + Intergenic
1178392446 21:32210187-32210209 ATGAAGAAACAGGCAAGAAAAGG - Intergenic
1178464479 21:32834366-32834388 ATGAAGAGACATGTTCAGAGTGG + Intergenic
1178926060 21:36776005-36776027 AAGAGGACACAGTCTCAGAAAGG + Intronic
1179367951 21:40775992-40776014 ATAAAGAAACAGGCTAAAAAGGG - Intronic
1179538706 21:42069584-42069606 GTGAGAAAACAGGTTCAGAAAGG - Intronic
1180451919 22:15471498-15471520 ATGCAAAACCAGCCTCAGAATGG + Intergenic
1181145690 22:20844820-20844842 ATGATGAAACAGACACAGAGAGG + Intronic
1181584599 22:23846188-23846210 ATGAGAAAATAGGCTCAGAGAGG + Intergenic
1181689567 22:24551062-24551084 AGGAAGAAGCAGGCACAGAGAGG - Intronic
1181693901 22:24583369-24583391 ATGAGGGAACAGGCTCTGAGAGG + Intronic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1181803754 22:25362869-25362891 ATGAGGAGACAGGCCCAGAGAGG - Intronic
1181853671 22:25767799-25767821 ATTAAAAAACAGACTCAGAGAGG + Intronic
1181900641 22:26152732-26152754 ATGAGGAAACAGGTACAGAGAGG - Intergenic
1181937282 22:26447997-26448019 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182438145 22:30344499-30344521 AAGCAGAAACAGGCTCAGAAAGG - Intronic
1182448264 22:30402491-30402513 ATGAGAAAACAGGCTCAGAGAGG + Intronic
1182553062 22:31111929-31111951 GTTAGGAAACAGGCTCAGAAAGG + Intronic
1182846728 22:33437408-33437430 ATGAAGAAGCAAGCACAGAGAGG - Intronic
1183032476 22:35116426-35116448 GTGTGGAAACAGGCTCAGAGAGG + Intergenic
1183072161 22:35403638-35403660 AGGAGGAGACAGGTTCAGAAAGG - Intronic
1183083546 22:35472738-35472760 ATAAGGAAACAGGTTCAGAGAGG - Intergenic
1183195681 22:36352006-36352028 ACTAGGAAACAGACTCAGAAAGG + Intronic
1183207661 22:36430848-36430870 TTGAAGAAACTGGCTGAGCACGG - Intergenic
1183228345 22:36565235-36565257 ATGAGGAAACAAGCACAGAGAGG + Intronic
1183236738 22:36624408-36624430 ATGAGAAAACAGGCCCAGAGAGG + Intronic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1183370567 22:37429406-37429428 AGGAGGAAACAGGCTCAGAGAGG - Intergenic
1183445990 22:37855473-37855495 ATGAGGACCCAGGCTTAGAAAGG - Intronic
1183456713 22:37926920-37926942 ATGAGGCAACAGGCTTAGAGAGG - Intronic
1183466349 22:37982287-37982309 ACCAAGAGACAGGCCCAGAAAGG - Intronic
1183575390 22:38685155-38685177 AAGAGGAAACAGCCACAGAAAGG + Exonic
1183650200 22:39149257-39149279 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1183730179 22:39614158-39614180 ATGAAGAAACTGAGACAGAAGGG - Intronic
1184014148 22:41772943-41772965 AGGAAGACCCAGGCTGAGAAAGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184088390 22:42279693-42279715 ATGAGCAAACAGGCTCAGGGAGG + Intronic
1184095470 22:42314081-42314103 AGGCAGATACAGGCTCAGCAGGG + Intronic
1184101962 22:42345441-42345463 GAGAAGAAACAGGTTCAGACTGG + Intergenic
1184125546 22:42484134-42484156 ATAAACAAAAAGTCTCAGAAAGG - Intergenic
1184204369 22:42992063-42992085 ATGAAAAGACAGCCTCAGACAGG + Intronic
1184391100 22:44204133-44204155 AAGAAGAAACAGGCTAGGCACGG - Intronic
1184410612 22:44323982-44324004 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1184444117 22:44537259-44537281 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1184467227 22:44676022-44676044 TTGTAGAAACTGGCTCAGATGGG + Intronic
1184473489 22:44708654-44708676 ATGAGCAAACAGGCTCGGAATGG + Intronic
1184569838 22:45315602-45315624 ATGGAGAAACAGGTTTAGAGAGG + Intronic
1184574703 22:45353736-45353758 ATGAAGAAACAGACCCAGAGAGG + Intronic
1184677459 22:46051513-46051535 CTGTAGCAACAGGCTCAGAGAGG + Exonic
1184841324 22:47053969-47053991 AGGAGGAAACAGGCTGAGAGAGG + Intronic
1185019472 22:48365735-48365757 ATGAAAAAACAGGCCAAGAGAGG - Intergenic
1185183608 22:49378873-49378895 ATAAAGAAACGAGATCAGAATGG + Intergenic
949211795 3:1511842-1511864 ATTAAGAAACAGTCTCTGTAGGG + Intergenic
949680324 3:6506114-6506136 ATAAGGAAACAGGATCACAAAGG - Intergenic
949754996 3:7399087-7399109 ATGAAGGAAAATGCTCTGAAGGG - Intronic
949984122 3:9525853-9525875 GTTATGAAACAGGCACAGAAAGG + Intronic
950131162 3:10547602-10547624 ATGAGAAAACAGGCCCAGAGAGG + Intronic
950180785 3:10911756-10911778 ATAAGGAAACAGCCTCAGAGAGG + Intronic
950185650 3:10943829-10943851 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
950192302 3:10985932-10985954 GTGAGGAAACAGGCACAGAGAGG - Intergenic
950215862 3:11158391-11158413 GAGAAGAAACAGGTTCAGAGGGG + Intronic
950290934 3:11783864-11783886 ATCAGGAAACAGGCTCAAAGAGG - Intergenic
950347099 3:12306424-12306446 ATGAAGAAACAGGAACAGAGAGG + Intronic
950452926 3:13075456-13075478 AGGCGGAAACAGGCTCAGAGTGG + Intergenic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
950577095 3:13838493-13838515 TTGAAGGACCAGGCTCAGAGAGG - Intronic
950660771 3:14465595-14465617 ATGAGGAAACAGGTCCAGAGAGG + Intronic
950665042 3:14490214-14490236 ATGAGGAAACAGGCACAGAGAGG - Exonic
950756301 3:15175676-15175698 ATTAAGCAACATGCTGAGAAAGG + Intergenic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951417309 3:22440531-22440553 ATGATGAAACTGGATCATAAAGG - Intergenic
951717154 3:25662191-25662213 ATAAAAAAACAGGCTTAGAAAGG + Intronic
951720891 3:25696914-25696936 ATGCAAAAAGAGACTCAGAAAGG + Intergenic
951845961 3:27084840-27084862 ATGAGAAAACAGGCTCAGAGAGG - Intergenic
952140494 3:30473567-30473589 ATGAGGAAACAGGCTAAGGGAGG - Intergenic
952176311 3:30867058-30867080 ATGAGAAAACAGGCACAGAGAGG - Intronic
952421930 3:33140188-33140210 ATAAGGAAACAAACTCAGAAAGG + Intronic
952460680 3:33522302-33522324 AAAAAGGTACAGGCTCAGAAAGG + Intronic
952515728 3:34103361-34103383 ATGAGGAAACAGCCTCAGAAAGG - Intergenic
952521619 3:34164920-34164942 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
952528777 3:34241878-34241900 ATGAAGAAACATGATCAGAGAGG - Intergenic
952840352 3:37640795-37640817 GTGAGGAAACAGGCTCTAAAGGG - Intronic
953563961 3:44015242-44015264 ATTAAGAAACTGGCTCAGAGAGG + Intergenic
953658416 3:44872222-44872244 ATGATGAAAGAAGCTCAGAGAGG + Intronic
953957646 3:47244145-47244167 ATGCAGAAACAGGCACAGAGCGG + Intronic
953961948 3:47273312-47273334 ATGAGGAAACAGGCTCAGTGTGG + Intronic
953963999 3:47288290-47288312 ATGAAGACCCAAGCCCAGAAAGG + Intronic
953971099 3:47347661-47347683 ATAAGGAAACTGCCTCAGAATGG + Intergenic
953987043 3:47452094-47452116 AAGAAGAAATAGGCTCTGTAAGG - Intronic
954460973 3:50626746-50626768 ATGCAGAGACAGGTTCAGAAAGG + Intronic
954552856 3:51496641-51496663 ATGAGGAAACTAGCTCAGAGAGG + Intronic
954598146 3:51845268-51845290 TTTAAGAAACAGGGCCAGAAAGG + Intergenic
954704254 3:52470693-52470715 ATGAAGCAAGAAGCTTAGAAAGG - Intronic
954792351 3:53142776-53142798 ATGGGGAAACAGGCTCTGCAGGG - Intergenic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955209250 3:56925661-56925683 ATGAGGAAAGAGGCTCAGAAGGG + Intronic
955244775 3:57214532-57214554 CAGAAGAAACAGGCTCAAAAAGG - Intronic
955335388 3:58081270-58081292 ATGAAGAAACAAGCACACATGGG - Intronic
955614022 3:60786508-60786530 ATGAAGTAACAGACTCAGGTAGG - Intronic
955822663 3:62912593-62912615 ATGAGCAACCAGGCTCAGAGGGG + Intergenic
955830571 3:62997970-62997992 ATGAAGAAAAATGATTAGAATGG + Intergenic
956302239 3:67784831-67784853 ATGAGGAAACAGGCTTAGAAAGG + Intergenic
956320047 3:67986358-67986380 ATGAGAAAACAGCCTCAGATAGG - Intergenic
956400824 3:68877970-68877992 ATGATAAAACAGGTTCAGAGAGG + Intronic
956450942 3:69374242-69374264 GTAAATAAACAGGCTTAGAAAGG + Intronic
956541136 3:70340953-70340975 AAGAGGGAACAGACTCAGAAAGG - Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956687061 3:71839892-71839914 ATAGAGAAACAGGCTTAGAGAGG + Intergenic
956743786 3:72295469-72295491 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
956772219 3:72536301-72536323 ACTAGGAAACAGGCTCAGAGAGG + Intergenic
956881584 3:73516525-73516547 ATGTAGAAACACGTTAAGAAAGG + Intronic
956909317 3:73800964-73800986 ATGATGAAGCAAGCTCAGAGAGG - Intergenic
957264927 3:77950761-77950783 ATGAAGAAAAAGCATCAGAAAGG - Intergenic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
958927418 3:100173890-100173912 ACAAAGAAACAGGCTGAGAAGGG - Intronic
958982631 3:100741184-100741206 CTGTAGAACCAGGCTCAGATAGG + Intronic
959552567 3:107679687-107679709 ATGAACAAACAGAACCAGAAAGG + Intronic
959572386 3:107898960-107898982 ATGAGGAAACAAGCTTAGAGGGG + Intergenic
959682558 3:109112524-109112546 ATGAAGAAAGAGGGACTGAAGGG + Intronic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
959799014 3:110467655-110467677 ATGAGGCAACAGGCACAGAGAGG - Intergenic
960515758 3:118600662-118600684 CTGAGGAAACATGCTCAGAAAGG + Intergenic
960515853 3:118601926-118601948 CTGAAGAAGTATGCTCAGAAAGG - Intergenic
960579556 3:119264582-119264604 AAGAAGAAATAGGCTGAGCACGG + Intergenic
960584808 3:119310906-119310928 CTGAAGAAACAGGCTTTTAAAGG + Intronic
960701288 3:120441854-120441876 ATGGGGAAACAGGCTCAGAGAGG + Intronic
961062665 3:123844558-123844580 ATGAGTTAACAGGCTTAGAAAGG - Intronic
961115698 3:124327923-124327945 AAGAGGAAACAAGCTCAGAATGG - Intronic
961119435 3:124361090-124361112 ATGAGGAATCAGGCTTAGAGAGG + Intronic
961175581 3:124832382-124832404 ATGAGGAAACAAGCCTAGAAAGG - Intronic
961359571 3:126358333-126358355 ATGAAGAAACCGACTCAGAGAGG + Intergenic
961385106 3:126518738-126518760 ATGAAGAAACAGGTGGAGAGAGG + Intergenic
961517928 3:127450040-127450062 ATAATGAAACAGGCTCATAGAGG - Intergenic
961556442 3:127699541-127699563 ATGAGGAGACAAGCTCAGAGAGG + Intronic
961590009 3:127971777-127971799 ATGATGAAAATGGCTCAGATGGG - Intronic
961818611 3:129564007-129564029 AGGAGGAAACAGGCTCATAGGGG + Intronic
961823504 3:129587099-129587121 CTCAGGAAACAGGCTCAGAGAGG - Intronic
961827020 3:129604443-129604465 ATGAAGAAACAGGCACAGAGAGG - Intronic
961983873 3:131111648-131111670 ATGAGGAAACAGGTTCAGAGAGG - Intronic
962016532 3:131446442-131446464 ATAAGAAAACAGGCACAGAAAGG - Intergenic
962451857 3:135525950-135525972 TCTGAGAAACAGGCTCAGAAAGG - Intergenic
962479203 3:135783956-135783978 ATGAGGAAACAGGCACAGGGAGG - Intergenic
962584665 3:136830061-136830083 ATCTAGAAACAGCCTCAAAAGGG - Intronic
962851630 3:139312582-139312604 ATGAAGAAACTGGTCCAGAGAGG + Intronic
962859112 3:139381163-139381185 ATAAATAAAGAGGCTCAGCATGG + Intronic
962970490 3:140396579-140396601 ATGAGGAAACAGGCACAGAGAGG + Intronic
963025592 3:140915959-140915981 ATGAAGGAACAAGCTCAGAGAGG + Intergenic
963129760 3:141847322-141847344 CTGAAGAAAGAGGCTCAAAATGG + Intergenic
963918206 3:150880153-150880175 GTGAGGAAACAGGCTCAGAGAGG + Intronic
964447364 3:156773978-156774000 ATGAGGAAACAGGTCTAGAAAGG + Intergenic
964450548 3:156808625-156808647 ATGAAGAAACAAATTCAGACAGG - Intergenic
964478913 3:157122744-157122766 ATGAGAAAACAGGCTCAGAAGGG + Intergenic
964497899 3:157313741-157313763 TTCAGGAAACAGGCTCTGAAAGG + Exonic
964514009 3:157486611-157486633 ATGAGGAAACAGACATAGAAAGG - Intronic
964575375 3:158160901-158160923 ATGAAGAAACAGACTTACAGAGG + Intronic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
965648091 3:170905800-170905822 ATGAGAAAACAGGCTCAGAAAGG + Intronic
965833621 3:172826849-172826871 GTGAAGAGACAGTCACAGAATGG + Intergenic
965889121 3:173489044-173489066 AAAAAGAAAAAGGCTGAGAAAGG - Intronic
965983547 3:174723213-174723235 ATTAGGAAATAGGCTCAGAAAGG - Intronic
966138667 3:176730174-176730196 ATGAGGAAATAGGTTCAGGAAGG + Intergenic
966327956 3:178778329-178778351 ATAAAAAAACAGGCTAAGACGGG + Intronic
966363544 3:179155951-179155973 GTGAAGAAACAAGCTCTGAAAGG - Intronic
966406288 3:179601866-179601888 ATAAAGAAACAGGTTTAGACAGG - Intronic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966945989 3:184777424-184777446 ATGAGGAAACAGGCCCAGGGAGG + Intergenic
967050637 3:185780818-185780840 CCGAAGAAACCAGCTCAGAAAGG + Intronic
967060375 3:185866895-185866917 GGGAAGAAACAAGCTCAGAGAGG + Intergenic
967189322 3:186972130-186972152 ATGAGGAAACAGGCATAGAGAGG + Intronic
967190198 3:186978231-186978253 AAGAAAAAACAGTCTCAGAGAGG + Intronic
967230701 3:187335071-187335093 ATGAGCAAACAGGCCCAGAGAGG + Intergenic
967322597 3:188209432-188209454 AGAAAGACACAGGTTCAGAATGG + Intronic
967789073 3:193527827-193527849 ATGGACAAACAGGCCCAGACAGG - Intronic
967980773 3:195063896-195063918 ATGAAGAAACAGGCCCAGAGAGG + Intergenic
968235525 3:197028522-197028544 AAGATGAAGCAGGCTCAGAGAGG - Intronic
968236108 3:197030611-197030633 AAGGAGAAACAGGCGGAGAAGGG + Intergenic
968351015 3:198051924-198051946 ATGCAGAAGCAAGTTCAGAAGGG - Intergenic
968531541 4:1094455-1094477 AGGAAGAAACAGGTAGAGAATGG + Intronic
968580370 4:1388344-1388366 ATGAATAAACAAGTTCAGCAAGG - Intergenic
969029654 4:4201616-4201638 ATGATGAAACAGGTTCAAAGTGG + Intronic
969257515 4:6012357-6012379 ATGAGGAAATAGGATCAGAGGGG + Intergenic
969377107 4:6770131-6770153 ATGAGGTAACAGGCTCAGAGGGG + Intergenic
969438241 4:7200740-7200762 ATGAGGAAAAAGGCTCAGAGAGG - Intronic
969552172 4:7877548-7877570 GTGAGGAAACAGACACAGAAAGG + Intronic
969688041 4:8687921-8687943 CTGAGGAAACAGGATCAGAGAGG + Intergenic
969906800 4:10404732-10404754 ATGAGGAAACAGGCACAGAGAGG + Intergenic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
970369583 4:15393680-15393702 TTGAGGAAACAGGCTTAGAGAGG - Intronic
970434358 4:16019070-16019092 ATGAGGAAATTGGCTCAGAGTGG - Intronic
970457081 4:16235419-16235441 ATGAAGAAATACGTTCATAATGG + Intergenic
971021435 4:22540447-22540469 ATGAATAAACAGCCTTAGAGAGG + Intergenic
971073308 4:23119757-23119779 GTGAGGAAACAGACTCAGAGGGG + Intergenic
971161280 4:24136659-24136681 GTGAGGAAACAGGCTGGGAAAGG - Intergenic
971263783 4:25080292-25080314 ATTAGGAGACAGGCTCAGAGAGG + Intergenic
971700923 4:29974238-29974260 ATGAAGACACAGTGTAAGAAAGG - Intergenic
971761883 4:30776607-30776629 CTGAAGAAACGGTCTCAGGAAGG - Intronic
971897753 4:32619071-32619093 CTGAGTTAACAGGCTCAGAAGGG + Intergenic
971996483 4:33972253-33972275 CTGCAGAAAAAGGGTCAGAAGGG - Intergenic
972243611 4:37221238-37221260 GTGAAGAAATAGGCTCAGAGAGG - Intergenic
972631240 4:40843805-40843827 ATGAGGAAACAAGTTCAGAGAGG + Intronic
973103631 4:46303306-46303328 GTGAAGAAGTAGGCTCAGAGTGG - Intronic
973367234 4:49217652-49217674 ATGTAGAAGCATGTTCAGAAGGG - Intergenic
973570967 4:52239310-52239332 ATGAAGAAACCAGCACAGCAAGG + Intergenic
973646188 4:52953475-52953497 ATAAAGAAACAAGCTCAGGGAGG + Intronic
973876299 4:55223093-55223115 ATGAGGAAACAGGTTCAGAGAGG - Intergenic
973977631 4:56279108-56279130 ATGGGGAAACAGGCTCAAAGAGG + Intronic
974034619 4:56807033-56807055 AAGAAGAAACAGGCTGGGCACGG + Intergenic
974553795 4:63416708-63416730 GTGAAAAAACAAGCACAGAATGG - Intergenic
975371055 4:73588608-73588630 ATGAGGACACAGGCACAGAGGGG - Intronic
975691815 4:76972910-76972932 ATGAGAAAACAGGCTCAGAAAGG + Intronic
975765387 4:77662227-77662249 ATGAAGAAACAGGATTCGCAAGG - Intergenic
975937595 4:79600476-79600498 GTGAAGCAGCAGGATCAGAATGG - Intergenic
975969998 4:80022029-80022051 ATGAAGAAACAAGCTTATAAAGG + Intronic
976082654 4:81374018-81374040 ATCTAGAAACAGCCTCAAAAGGG - Intergenic
976120649 4:81777462-81777484 AGAAAGAAACAGAATCAGAAAGG + Intronic
976799225 4:88969776-88969798 AGGAGGAAACAAACTCAGAAAGG + Intronic
977172528 4:93780799-93780821 AGGGAGAAACAGGCTCTTAAAGG + Intergenic
977191996 4:94012540-94012562 ATGAGGACACAGGCTCAGCATGG + Intergenic
978067036 4:104417708-104417730 ATGAAGAAACAGATTCAAAGAGG + Intergenic
978388805 4:108203155-108203177 ATGAAGAAAGGGGCCCACAAAGG - Intergenic
978545269 4:109865184-109865206 ATGAGAAAACAGGCTCAGCAAGG + Intronic
978564693 4:110069605-110069627 ACAAAGAAACAGGCACAGAGAGG + Intronic
979121088 4:116902670-116902692 ATAAAGAAACAGGTTCAACAAGG + Intergenic
979224410 4:118267617-118267639 ATGAGGAAACAGGTTTGGAATGG + Intergenic
979247108 4:118520019-118520041 GAGAAGAAACAGGCCCAGAGAGG - Intergenic
979375323 4:119939706-119939728 ATGAAAACAGAGGCTGAGAAAGG + Intergenic
979719952 4:123887386-123887408 AAAAAGAAACAAACTCAGAAAGG + Intergenic
980794573 4:137664216-137664238 ATACAGAAAGAAGCTCAGAATGG + Intergenic
980951472 4:139383278-139383300 ATCAAGAAATAGGTTCAGAGAGG + Intronic
981162320 4:141513357-141513379 GTGAAGAAACAAGATCAGATGGG - Intergenic
981207495 4:142060617-142060639 ATCAAGAAACAGCCACAGACGGG - Intronic
981688905 4:147484318-147484340 ATGAAGCAATAGACTCAGGAGGG - Intronic
981935805 4:150238764-150238786 ATGAAGAAATGTGCTCAGAGAGG + Intronic
982185402 4:152791974-152791996 ATGGATAAACAGGAACAGAATGG - Intronic
982246060 4:153352456-153352478 ATGAAGAAACAGACATAGAGAGG - Intronic
982256706 4:153458101-153458123 ATGAAGAAAAAGGCTAGGTATGG + Intergenic
982257338 4:153463739-153463761 ATGAAGAAAAAGGCTAGGTATGG + Intergenic
982364551 4:154560938-154560960 ATGGTGAAACAGGTTCAGAGAGG - Intergenic
982434059 4:155361603-155361625 ATCAACATACAGGGTCAGAAAGG + Intronic
983637856 4:169916510-169916532 ATGAAGAAAAAGGCTTATGAAGG - Intergenic
984103548 4:175516267-175516289 TTGAAGAAACAGGCTTAGGTTGG - Intergenic
984227204 4:177050069-177050091 TTGAAGAAAAAGGCTAAGAAGGG - Intergenic
984423305 4:179552658-179552680 AAGAAAACATAGGCTCAGAATGG + Intergenic
984502673 4:180576340-180576362 ATGAAGAAACAAACTTAGAGAGG + Intergenic
984776725 4:183487568-183487590 ATGAAGAAATAGGCTTACAGAGG - Intergenic
984776887 4:183489514-183489536 AGGAAGGAAGAGGCTCAGAAAGG - Intergenic
984833146 4:183994656-183994678 ATGAGGAAACGGGCGCAGAGCGG + Intronic
984891973 4:184502335-184502357 ATGAGGAAATAGGCTCAGAGTGG - Intergenic
985728911 5:1534060-1534082 ATGAAAAAGCAGCCACAGAATGG - Intergenic
985832741 5:2247446-2247468 AAGAAGAAACAGGAGGAGAAGGG - Intergenic
986199230 5:5566485-5566507 ATGAAGAAACGGCATCAGAAAGG + Intergenic
986427222 5:7645706-7645728 GTGAAGACTCAGGCTCATAAGGG - Intronic
986681829 5:10240541-10240563 ATGAGAAAACAGGCTCAGCAAGG - Intronic
986832657 5:11598124-11598146 ATGAGGAAACAGATTCAGAGAGG + Intronic
986981726 5:13455939-13455961 ATAAAAAAAAAGACTCAGAAGGG - Intergenic
987064690 5:14277827-14277849 ATGAAGAAAAAATCTTAGAAAGG - Intronic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
987431094 5:17834125-17834147 ATGGAGAAACATGCTATGAATGG - Intergenic
987535446 5:19181756-19181778 ATAAATAAACAACCTCAGAAAGG + Intergenic
988288942 5:29259575-29259597 ATAAAGACACAGGCACAGAAAGG + Intergenic
988569839 5:32353380-32353402 ATGAGGAAACGAGCCCAGAATGG - Intergenic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
988722808 5:33894981-33895003 ATGAGGAAACAGACACTGAAAGG + Intergenic
989074762 5:37552357-37552379 ATAAAGACACTGGTTCAGAAAGG - Intronic
989140053 5:38193058-38193080 AGGAAGAAACGCGCTCAGAGAGG + Intergenic
989213946 5:38884547-38884569 AGGAGGAAACTGGCTCAGAGAGG - Intronic
989300547 5:39886985-39887007 ATCAAGAAAGAGGAGCAGAAAGG - Intergenic
989695191 5:44191777-44191799 AGGAATAAAAAGGCTCAGAGAGG - Intergenic
989982789 5:50664024-50664046 AAGAGGAAACAGGCTCAAAGGGG - Intergenic
990220850 5:53586811-53586833 AGGAAGAAACAGGCTGGGCACGG - Intronic
990446324 5:55897138-55897160 ATAAAGAAACAGGCTGGGCATGG - Intronic
990810733 5:59720049-59720071 TGGAAGAAACAGCTTCAGAAGGG - Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992510241 5:77425633-77425655 ATGAAGAAATAGGCTCAGCAAGG - Intronic
992871417 5:81009123-81009145 ATGAGGAAACAGGCTGAAAGAGG - Intronic
992884829 5:81148161-81148183 TTGAAGGAACAGGCTCAGTGAGG + Intronic
992947758 5:81826100-81826122 ATGAGGACACAGGCTCAGGAGGG + Intergenic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993198017 5:84775364-84775386 ATGAAGAAACAAGTTTAGAATGG + Intergenic
994099446 5:95877734-95877756 AAGAAGAAACAGGCCAGGAAAGG - Intergenic
994672092 5:102774436-102774458 ATGAAAAAACTGACACAGAAAGG - Intronic
994684906 5:102937685-102937707 ATGAAGATCGATGCTCAGAAAGG + Intronic
994814782 5:104571307-104571329 TTTAAGAAACAGGCAAAGAACGG - Intergenic
995487210 5:112651447-112651469 CAGAAAAAAAAGGCTCAGAATGG + Intergenic
995731336 5:115245478-115245500 TGGAAGAAACTGGCTCAGAGAGG - Intronic
995798463 5:115965048-115965070 ATGAGGAAACAGACTCAGAGAGG - Intronic
996439805 5:123477477-123477499 ATCGAGAAACAGGCCAAGAAGGG - Intergenic
996861665 5:128073966-128073988 AAGAAGAAACAGATGCAGAAAGG + Intergenic
996946691 5:129078948-129078970 AAGAAGAATGAGGCTCAGAGAGG - Intergenic
997235307 5:132269072-132269094 ATAAAGAAACAGGTTCAGAGAGG + Intronic
997517039 5:134497324-134497346 ATTAAGAATAGGGCTCAGAAAGG + Intergenic
997639636 5:135440207-135440229 ATGAGGAAACAGGATCAGAGAGG - Intergenic
997725115 5:136113839-136113861 AGGAAGCAACAGGCTGAGACTGG + Intergenic
997732199 5:136190004-136190026 ATGAGGAAATAGGCTCAGATAGG + Intergenic
997854451 5:137360862-137360884 ATGTAGAAACATGTACAGAAGGG - Intronic
997890038 5:137667968-137667990 ATGAGGAAACAGCCTGAGAGAGG + Intronic
998205860 5:140156403-140156425 ATGAGGAGACAAGCTCGGAAAGG + Intergenic
998229929 5:140354589-140354611 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
998368053 5:141643938-141643960 GTGAAGAAACAAGCTCAGAGAGG + Intronic
998501225 5:142634560-142634582 ATGAGGAACCAGACTCAGAGCGG - Intronic
998532875 5:142901686-142901708 ATGAGGAAGCAGGTTCAGAGAGG - Intronic
998742586 5:145221780-145221802 ATGGAGAAACAAGCACAGAGAGG - Intergenic
998813091 5:145986103-145986125 TTGAGGAAACAGGCCCAGAGAGG + Intronic
998892963 5:146766640-146766662 ATGAGAAAACAGGCTCAGAGAGG + Intronic
998930361 5:147174562-147174584 AAGAAGAAACAGGCTTAGAAAGG + Intergenic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999159233 5:149481568-149481590 TTGAGGACACTGGCTCAGAAAGG - Intergenic
999307844 5:150532033-150532055 ATGAAGACACAGGCTTACAGCGG + Intronic
999415095 5:151388080-151388102 CTGAAGAAAAAGGCCTAGAAAGG - Intergenic
999665024 5:153904039-153904061 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
999754090 5:154651780-154651802 ATGAGGAAACAGGCTCTGTCCGG - Intergenic
999805480 5:155077225-155077247 ATGAGAAAACAGGCTCAGGGAGG + Intergenic
1000040528 5:157481499-157481521 ATGAGGAAACAGACTCAAGAGGG + Intronic
1000178184 5:158779043-158779065 AAGAAGAAAGAGGCTCTGAAGGG + Intronic
1000357864 5:160418291-160418313 GTGAAGAAACAGGTTCTGAGAGG + Intronic
1000383350 5:160648712-160648734 ATGTGGAAACAGGCTCAGAGAGG + Intronic
1001176018 5:169469669-169469691 ATGAGGAAACAGAGTCAGAGAGG + Intergenic
1001244855 5:170098474-170098496 GTGAGGACACAGGCACAGAATGG + Intergenic
1001279420 5:170375867-170375889 ACGAGGAAACAGGCACAGAAAGG + Exonic
1001370800 5:171198829-171198851 CTGAAGAAACAGGCAGAGAAAGG - Intronic
1001399131 5:171436399-171436421 ATCAGGAAACAGACCCAGAAAGG - Intronic
1001399872 5:171440099-171440121 AAGAGGAAACAGGATCAGAAAGG - Intronic
1001414729 5:171537147-171537169 ATGATGAAACAGGCTCCAAGGGG - Intergenic
1001431297 5:171664783-171664805 CCGAGGAAACAGGCTCAGAGAGG + Intergenic
1001516302 5:172357540-172357562 ATGAGGAAACAGGGTCTGAGAGG - Intronic
1001553855 5:172623069-172623091 ATTAAGAAACAGGCTCAGAGAGG - Intergenic
1001594231 5:172887494-172887516 AGGAGGAAACAGGCTCCGAGAGG + Intronic
1001741022 5:174052725-174052747 GTGCAGAAACAGGCTCAGACAGG + Intronic
1001913812 5:175542780-175542802 ATGAGAAAACAGGCTCAAAGAGG - Intergenic
1001925041 5:175630091-175630113 ATGAAGAGTGAGACTCAGAAAGG - Intergenic
1002033996 5:176451581-176451603 ATGAAGAAACAGGTTCTGAGAGG + Intronic
1002052527 5:176579356-176579378 AGGAGACAACAGGCTCAGAAAGG + Intronic
1002053273 5:176584033-176584055 ATGAGGAGACAGGCTCTGAGAGG - Intronic
1002101741 5:176861321-176861343 GTGAGGAAACAGGTTCAGGATGG + Intronic
1002122868 5:177019242-177019264 ATAAAGAAACAGACTAGGAAAGG - Intronic
1002174423 5:177393539-177393561 TGGAAGAGACAGGCTCAGAGAGG + Intronic
1002533649 5:179864281-179864303 ATCAGGACACAGGCTCAGAGAGG + Intronic
1002762566 6:213390-213412 GTGAAGACACAAGCTCAGAGAGG - Intergenic
1002941630 6:1721873-1721895 TTTCAGAAACAGGATCAGAAAGG + Intronic
1003413299 6:5885310-5885332 ATCAAGTAACAAGGTCAGAAAGG - Intergenic
1003538384 6:6996344-6996366 GTGATGGAACAGGCTCAGAGAGG - Intergenic
1003959930 6:11199372-11199394 ATGAGAAAACAGGCTTAGAATGG - Intronic
1004278056 6:14255506-14255528 ATGAAGAAACGGGCCCAGAGAGG - Intergenic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1004477354 6:15986237-15986259 AGGAGGAAACAGGCCCAGAGAGG - Intergenic
1005816885 6:29560310-29560332 TTGAAGAAACATGCTCTGAGAGG - Intronic
1006099578 6:31678087-31678109 ATGAGGAAACAGGTGCAGAAAGG - Intronic
1006428651 6:33981942-33981964 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1006520772 6:34569878-34569900 ATGAGGAAACAGGCCCAGAGAGG + Intergenic
1006671216 6:35730960-35730982 ACGAAGAAACTGGCTCAGAGAGG - Intergenic
1006804246 6:36778121-36778143 ATGAGAAAACAGGCCCAGAGAGG + Intronic
1006811632 6:36824028-36824050 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1006836917 6:37004610-37004632 AGGAAGAAACAGAATCAGAGAGG - Intergenic
1006841242 6:37029134-37029156 ATGAAGACACCGACTCAGAGAGG + Intergenic
1007100144 6:39240434-39240456 GTGAGGAAACAGGTTCAGAGGGG + Intergenic
1007110780 6:39312533-39312555 GTGAAGAAACAGGCTCAGAGAGG - Intronic
1007209662 6:40182643-40182665 ATGAAGAAGCAGGGTCACACTGG + Intergenic
1007340770 6:41190230-41190252 ATGAGGAAACAAGATCAGAGAGG + Intergenic
1007367941 6:41407670-41407692 ATGAAAAGACAGACTCAGTAGGG - Intergenic
1007428679 6:41763778-41763800 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1007431298 6:41779035-41779057 AGGAAGAAGCAGGCTCAGGGAGG + Intronic
1007456316 6:41980099-41980121 AGGAAGTATCAGGCTCAGATAGG + Intronic
1007576545 6:42928885-42928907 AAATAGAAACAGGCTCAGAGAGG + Intergenic
1007694729 6:43724998-43725020 GTGGGGAAACAGGCTCAGAGAGG + Intergenic
1007703193 6:43776148-43776170 ATGCTGAAACAGGCTGAAAAAGG - Intronic
1007744745 6:44036648-44036670 ATGAAGAAACAGACTCTAGATGG + Intergenic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1008900627 6:56611264-56611286 ATAAGGAAACAGGCTCAGAGAGG - Intronic
1009937117 6:70246888-70246910 ATGAGGAAACAGGCACGGAGAGG - Intronic
1010093785 6:72015389-72015411 ATTAATAAACAAGCTCAGCAAGG - Intronic
1010388340 6:75308397-75308419 ATGAGGAAACAGGCTCAGATGGG + Exonic
1010510655 6:76715070-76715092 ATGAAGAGAAAGGCAGAGAAGGG + Intergenic
1011603244 6:89079317-89079339 CTGGGGAAACAGGCTTAGAAAGG - Intergenic
1012003369 6:93682241-93682263 AAGAATAAACAGGATCAGAAAGG - Intergenic
1012031616 6:94074955-94074977 ATCAGAAAACAGGCTGAGAAAGG - Intergenic
1012128680 6:95463190-95463212 ATAAAGAAAAAGGGTCAAAATGG - Intergenic
1012230441 6:96754746-96754768 ATGAGGAAACAGGCACAAATAGG + Intergenic
1012347342 6:98207151-98207173 ATGAGAAAACAGGTTCAGAATGG + Intergenic
1012627289 6:101419671-101419693 AGGAAGAAACAGGCTGAGAGAGG + Intronic
1012840636 6:104324994-104325016 ATGTAGAAACAGCCTCTGGATGG - Intergenic
1012919151 6:105203398-105203420 ATGGAGAAACAGGCTTAGAGTGG - Intergenic
1013425620 6:110009995-110010017 AGGAAGAAATAGGCTCAGAGAGG + Intergenic
1013609399 6:111779939-111779961 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1014044933 6:116874762-116874784 AGAAGGAAACAGGCACAGAAAGG + Intergenic
1014114278 6:117654836-117654858 ATGAAGAAACAAACACTGAAAGG - Intergenic
1014549383 6:122772297-122772319 ATCTAGAAGCAGGCTAAGAATGG + Intergenic
1014685400 6:124492989-124493011 ATGAAGACACAGGCTTACAGTGG - Intronic
1015073199 6:129122825-129122847 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1015107264 6:129551505-129551527 ATGAGGAAACAGACTCAAAGAGG - Intergenic
1015170195 6:130243552-130243574 GTTAAGAAACAGGCTTAGCAAGG + Intronic
1015702415 6:136050955-136050977 ATAAACAGACAGGCTCTGAACGG - Intronic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1015879590 6:137857757-137857779 ATGAAGAAACGGCCTCAGTGAGG - Intergenic
1015954743 6:138587974-138587996 ATGAGGAAACAGAACCAGAAAGG + Intronic
1016090897 6:139977614-139977636 ATGAGGAAACAGACACAAAAAGG - Intergenic
1016422133 6:143896562-143896584 ATAAGGAAACAGGTTCAGCAAGG - Intronic
1016709867 6:147157170-147157192 CCAAAGAAACAGGCTAAGAAGGG + Intergenic
1017044759 6:150337177-150337199 AGGAACAAATAGGCACAGAAAGG + Intergenic
1017136227 6:151150005-151150027 ATGATAAAACAGATTCAGAAAGG + Intergenic
1017482258 6:154869288-154869310 ATGTCGAAACAGGTGCAGAAAGG - Intronic
1017822200 6:158057532-158057554 ATGAAGGAGCCAGCTCAGAAGGG + Intronic
1019026252 6:168965706-168965728 ATGAAGAAACAGACCCAAAGAGG + Intergenic
1019503186 7:1375764-1375786 AAGAAAAATCAGGCTGAGAAGGG - Intergenic
1019509159 7:1408645-1408667 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1020446730 7:8276666-8276688 ATGAAAAAACTGGCTTAGAGAGG - Intergenic
1021249878 7:18311542-18311564 ATGAGGAAATAGGCACAGAGAGG + Intronic
1021601372 7:22367302-22367324 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1021747791 7:23760591-23760613 GTGAGGAAACAGGCTTACAAGGG + Intronic
1021800443 7:24300186-24300208 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1022049418 7:26651246-26651268 GTGAGAAAACAGGCTCAGAGAGG + Intergenic
1022506338 7:30910485-30910507 TGGAAGAACCAGGCCCAGAAGGG - Intergenic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1022655699 7:32317978-32318000 ATAAAGAGACAGGGTCAGAGAGG + Intergenic
1022755254 7:33280783-33280805 ATGAAAAAACAGACTCATAGAGG + Intronic
1022782223 7:33597767-33597789 ATCAAGACAGAGGCTCAGAGAGG - Intronic
1023132623 7:37017987-37018009 ATGAGGAAACAGGTTCAGGGGGG - Intronic
1023186096 7:37534695-37534717 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1023289813 7:38657256-38657278 ATGAGGAAACAAGAGCAGAAAGG - Intergenic
1023336448 7:39175671-39175693 ATGAAGAAAGGGGCCCACAAAGG + Intronic
1023429875 7:40079603-40079625 AGGAGGAAGCAGGCTCAGAGAGG + Intronic
1023443289 7:40206325-40206347 TTGAAGAAACATGCAAAGAATGG - Intronic
1024954034 7:54896993-54897015 ATGAAGAATTAAGCACAGAATGG - Intergenic
1025805637 7:64830611-64830633 ATGAAGATACAGGCTGGGCATGG - Intronic
1025834932 7:65085561-65085583 ATGGGGAAACGGGCTCAGAGAGG - Intergenic
1026586546 7:71660454-71660476 ATGAAGAGAAATGCACAGAAAGG - Intronic
1026823718 7:73567840-73567862 CTGAGGAAACAAGCTCAGAGAGG + Intergenic
1026836933 7:73645852-73645874 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1026990526 7:74582617-74582639 ATGTGGAAACAGGCTCAGAGAGG + Intronic
1028003469 7:85531400-85531422 ATGAAGACAGAGGCTGAGACTGG - Intergenic
1028102353 7:86836832-86836854 ATTAGGAAACAGAGTCAGAAAGG + Intronic
1028164295 7:87520273-87520295 TATAAGAAACAGACTCAGAAAGG + Intronic
1028385512 7:90248850-90248872 ATGAGGAAACAGACACAGAAAGG - Intronic
1028390262 7:90308147-90308169 ATGAATAAGCAGGTTCAGAATGG - Intronic
1028618812 7:92801485-92801507 ATGAGGAAACAGGCAGGGAATGG + Intronic
1028764169 7:94531900-94531922 ACAAAGATACAGACTCAGAATGG - Intronic
1028912076 7:96219526-96219548 ATGAGGAAACAGGCCCAGAGGGG - Intronic
1028915423 7:96253451-96253473 ATGAGAAAACAGGCTCACATGGG + Intronic
1029260355 7:99298109-99298131 ATGAGGAAACATGTTCAGCAAGG - Intergenic
1029506761 7:100967727-100967749 ATGAAGGAACGGGGTCAAAAGGG - Exonic
1029506805 7:100967919-100967941 ATGAATGGACGGGCTCAGAAGGG - Exonic
1029581908 7:101441935-101441957 ACCAGGAAACAGGCTCAGAGAGG + Intronic
1029603798 7:101586135-101586157 ATGAGGACACTGGCTCAGAGAGG + Intergenic
1029843202 7:103387588-103387610 ATGCAGAAACAGGCTCTGAGAGG + Intronic
1030009885 7:105155343-105155365 ATGAGGAAACAGACTCACAGAGG + Intronic
1030078896 7:105760359-105760381 ATGAGGAAACAGGCTCTGAGAGG + Intronic
1030224644 7:107136374-107136396 ATGAAAAGACAGGCTCAGACTGG + Intronic
1030296532 7:107934467-107934489 AGGAAGAAACAGGCTCAGTTAGG + Intronic
1030625841 7:111845205-111845227 GTGAAGATTCAGGCTCAGAGAGG - Intronic
1030640043 7:111994461-111994483 AAGAAGGAACAGCATCAGAAGGG + Intronic
1030665934 7:112278625-112278647 TTGTGGAAACAGGCTAAGAAAGG + Intronic
1031337993 7:120561486-120561508 GTGAGGAAACAGATTCAGAAAGG + Intronic
1031514251 7:122682782-122682804 ATGAGGAAACTGACCCAGAATGG - Intronic
1031845822 7:126805132-126805154 CTAAAGAAATTGGCTCAGAAAGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1031976931 7:128100045-128100067 ATGAGGGAACCGCCTCAGAAAGG - Intergenic
1032001934 7:128271322-128271344 CTGAGGAAACAGGCCCAGAATGG - Intergenic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1033244921 7:139709763-139709785 ATAAAGAAATAGGCTCTGAAAGG - Intronic
1033609334 7:142950918-142950940 AAGCAAAAATAGGCTCAGAAAGG - Intronic
1033640796 7:143262092-143262114 ATGAGGAAATAGGTTCAGAGAGG + Intronic
1033782178 7:144684291-144684313 ATGAAGAACAAAACTCAGAAAGG - Intronic
1034077631 7:148247942-148247964 CTGAAGAAAGAGGCTGAGCATGG - Intronic
1034639501 7:152591397-152591419 ATAAGGAAACAGGCCCACAAAGG - Intergenic
1034946370 7:155264772-155264794 TTGAGGGTACAGGCTCAGAAAGG - Intergenic
1035956647 8:4087933-4087955 GTGACCAAACAGGCTAAGAACGG + Intronic
1036624407 8:10455157-10455179 AAGTATAAACAGACTCAGAAAGG - Intergenic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1036652090 8:10651092-10651114 ATCAGGAAGCAGGCTCAGAAGGG + Intronic
1036776574 8:11617101-11617123 ATGAACAAACAGAATCAGAGAGG + Intergenic
1036784399 8:11676411-11676433 ATGAGGTAACCGGCTCAGAGAGG - Intergenic
1036828140 8:11995611-11995633 ATGAGGAAACAGATTTAGAACGG - Intronic
1036990334 8:13585271-13585293 ATGAAGAAATAGGCCTAGCATGG + Intergenic
1037122524 8:15306053-15306075 TGGAAGGAACAGGCTCAGGAGGG - Intergenic
1037565097 8:20111315-20111337 CTGAAGAAACAGACTCTGATGGG + Intergenic
1037807168 8:22064930-22064952 ATAAGGAAACGGGCTCAGAGAGG - Intronic
1038290415 8:26244273-26244295 GTGAGGAAACAGACTCAGAAAGG - Intergenic
1038413683 8:27377587-27377609 AAGGAGACACTGGCTCAGAAAGG - Intronic
1038421728 8:27438027-27438049 ATGAGGACACAGGGTCAGAGAGG - Intronic
1038564788 8:28610677-28610699 ATGAAGAAATGGGCTCAGGTTGG + Intronic
1038777121 8:30541207-30541229 ATGAGGAAACAGATGCAGAAAGG - Intronic
1038967047 8:32585978-32586000 ATGAAGAAACAGAAACAGAGAGG - Intronic
1039597232 8:38801370-38801392 ATGCAGAAACTGACTCAAAATGG - Intronic
1039635430 8:39159560-39159582 AGGAAGAAAGAGGCTGAGGAAGG - Intronic
1039894711 8:41708601-41708623 ATGAATAAACAGAGTCAGAAAGG - Intronic
1039911380 8:41829412-41829434 ATGCAGAAAGAGGCTCAGAGAGG + Intronic
1039975666 8:42362755-42362777 ATGAAGTCACACACTCAGAATGG - Intronic
1040636639 8:49282668-49282690 ATAAAGAAAGAGGAACAGAAAGG + Intergenic
1041053661 8:53961010-53961032 ATGAGGAAGCAGGCCCAGAAAGG - Intergenic
1041094110 8:54332255-54332277 ATGAAGAAGGAGGTTCAGAGAGG - Intergenic
1041356744 8:57008484-57008506 TTGAAGAAACAGCTTCAAAATGG - Intergenic
1041489209 8:58412749-58412771 ATGAAGACACAGGATCAGACAGG - Intronic
1041531721 8:58875865-58875887 CTGAAGATACAGTCCCAGAATGG - Intronic
1041571245 8:59338949-59338971 ATGAAGAAACATGGACTGAAGGG + Intergenic
1041618104 8:59931848-59931870 ATGAAACATCAGGCTCAGATCGG + Intergenic
1041719318 8:60961892-60961914 AGGAAGGCACAGTCTCAGAACGG + Intergenic
1041746892 8:61217104-61217126 ATCATGAAAAAGTCTCAGAAAGG - Intronic
1041777381 8:61538146-61538168 ACAAAAAAACAGGCTCAGATGGG + Intronic
1041794261 8:61729536-61729558 ATGGAGAAACATGCTCAGAGAGG + Intergenic
1042038665 8:64566861-64566883 AAAAAGAAACAGGCTCAGAGAGG + Intergenic
1042241466 8:66668082-66668104 CTTAGGAAACAGGCCCAGAAAGG + Intronic
1042694805 8:71545160-71545182 ATGAAAAAGCAGGTTCAGACTGG - Intronic
1042917663 8:73891201-73891223 ATAAGGAAACAGGCTTAGAGAGG + Intergenic
1043442641 8:80289833-80289855 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1043448913 8:80347049-80347071 AAGAAGAAAGAGGCTCAGAGAGG - Intergenic
1043487272 8:80710393-80710415 ATGAGGAAACAGCCACAGAGAGG + Intronic
1043860093 8:85306368-85306390 CCCAAGAAACATGCTCAGAATGG + Intergenic
1043880152 8:85532982-85533004 GTGTGGAAACAGTCTCAGAACGG + Intergenic
1043969752 8:86515666-86515688 ATGCAGAAACAGGCCCTAAAAGG - Intronic
1044106269 8:88210978-88211000 ATGAGGAAACAAGTTGAGAAGGG + Intronic
1044134531 8:88569881-88569903 ATGAAGGCTCAGGCTCAGTAAGG + Intergenic
1044481206 8:92691052-92691074 ATTATGAAACAGGCTAAGCAAGG - Intergenic
1044604167 8:94034411-94034433 ACGCAAAAACAGGCACAGAAAGG - Intergenic
1044626135 8:94236010-94236032 GGGAGGAAACAGGCTCAGAGAGG - Intergenic
1044791278 8:95849540-95849562 ATGAAGAAAGGGGATCAGATAGG + Intergenic
1044803160 8:95977724-95977746 AGGAAGAAACAGGCTCAGAGAGG - Intergenic
1044891852 8:96844513-96844535 ATGAGAAAACAGGCTCACACTGG - Intronic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1044938821 8:97319592-97319614 ATGAAGAAACAGGCCCAGTGAGG - Intergenic
1045051460 8:98330904-98330926 ATGAGGAAACTGGCTCAGAGAGG + Intergenic
1045061810 8:98417629-98417651 AGGGGGAAACAGGCACAGAAAGG - Intronic
1045653008 8:104359454-104359476 ATAAGAAAACAGGCTCAGAGAGG - Intronic
1046031525 8:108787962-108787984 ATGTGGAAACAGGCTCAGAGAGG + Intergenic
1046634893 8:116663314-116663336 ATGAAGAAACAGGCACTGATTGG + Intronic
1047119311 8:121882814-121882836 ATGATTAGAGAGGCTCAGAAAGG + Intergenic
1047141998 8:122152090-122152112 AAGAAATAAAAGGCTCAGAAAGG + Intergenic
1047154486 8:122301653-122301675 ATGAGAAAAAAGGCTCAGAAAGG + Intergenic
1047218861 8:122902415-122902437 CTGAGGAAACAGGCACAGAGAGG - Intronic
1047274472 8:123395539-123395561 ATGAAGAAACGGATTCAAAAAGG - Intronic
1047372373 8:124266745-124266767 AAGAGGAATCAGGCCCAGAAAGG + Intergenic
1047467983 8:125137804-125137826 AAGAAAATACAGGCTCAGAGAGG - Intronic
1047701360 8:127452502-127452524 AGGAAGAAACAGATCCAGAAAGG - Intergenic
1047713839 8:127577381-127577403 ATGAGAAAACAGGCTCAGACAGG - Intergenic
1047889951 8:129296646-129296668 TGGAAGAAAGAAGCTCAGAATGG - Intergenic
1047982621 8:130198669-130198691 ACGAGGAAACAGGCTTAGAGAGG + Intronic
1048018478 8:130518356-130518378 ATGAGGAAACTGGCTCAGAGAGG - Intergenic
1048140794 8:131792226-131792248 TTGAGGAAACAGGCTCAGAGAGG + Intergenic
1048247721 8:132827044-132827066 TTGAAGATACAGGATCAAAATGG + Intronic
1048253369 8:132885900-132885922 GTGAAGACACAGGCACAGATTGG - Intronic
1048299688 8:133242286-133242308 GTGAGGAAACTGGCTCAGACAGG - Intronic
1048453781 8:134558411-134558433 AAGAAGACAGAGGCTCAAAAAGG + Intronic
1048470383 8:134699452-134699474 ATTAGGAAACGGGCTCAGCAGGG - Intronic
1048511973 8:135071290-135071312 ATGAAGAAATAGGATCAGAAAGG - Intergenic
1048590479 8:135816617-135816639 ATGAAGAAAGAGGCAGAGATTGG + Intergenic
1048604873 8:135957014-135957036 AGGAAGAACCAGGCAGAGAAAGG + Intergenic
1048747728 8:137633637-137633659 ATGGAGATACAGGCACTGAAAGG - Intergenic
1049223770 8:141440065-141440087 ATGAGGAAACAGGCCCAGAGAGG + Intergenic
1049371889 8:142271854-142271876 ATGAGGAAACAGACCCAGAGAGG + Intronic
1049414620 8:142489581-142489603 GTGGGGAAACAGGCTCAGAGAGG + Intronic
1049939666 9:533350-533372 ATGGAAAAACAGACTTAGAAAGG - Intronic
1050447589 9:5741760-5741782 TGGCAGAAACAGACTCAGAAAGG - Intronic
1050964433 9:11780506-11780528 ATTAGAAAACAGGCTCAAAATGG - Intergenic
1050992573 9:12172150-12172172 AGGAAGTAACAGGCTAGGAAGGG - Intergenic
1051189878 9:14500160-14500182 ATGAGGAAACAGGCACAGAGAGG + Intergenic
1051436481 9:17038521-17038543 AAGAAGAAACTAGCTCAGAGAGG - Intergenic
1051550922 9:18328549-18328571 CTGAAGAAACATACCCAGAAGGG + Intergenic
1051782605 9:20706648-20706670 ATGAAGAAACAATGTCAGAGAGG - Intronic
1051854642 9:21550002-21550024 ATGAGGAGACAGGATCAGAGAGG - Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052412256 9:28136908-28136930 ATGAACAAAAAGGCTGAGTAAGG + Intronic
1052820062 9:33131276-33131298 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1052879869 9:33594927-33594949 ATGTAGAAGCAGTTTCAGAAGGG + Intergenic
1053153087 9:35755175-35755197 ATGAGGAAACAGGCTCAGAGAGG - Exonic
1053432155 9:38049649-38049671 AAAAGGAAACAGGCTCAGAGAGG + Intronic
1053471994 9:38353192-38353214 ATGTGGAAACAGGCTCAGAGGGG - Intergenic
1053496110 9:38549293-38549315 ATGTAGAAGCAGGTTCAGAAGGG - Intronic
1053665650 9:40315683-40315705 ATGTAGAAGCAGGTTCAGAAGGG + Intronic
1053915233 9:42940730-42940752 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054376806 9:64455713-64455735 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054518964 9:66060601-66060623 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1054519394 9:66063548-66063570 ATGCAGGAACAGGTTCAGAAGGG - Intergenic
1054712648 9:68526594-68526616 TTGAAGAAAGAGGATCACAATGG - Intronic
1054885319 9:70191490-70191512 ATCAAGAAACAGGACCAGAGGGG - Intronic
1054974765 9:71129550-71129572 ATGAGGAAATAGCCTCAGACTGG + Intronic
1055081036 9:72267733-72267755 ATCAGGAAACAGGTTCAGAAAGG + Intergenic
1055379580 9:75691236-75691258 ATCAAGAAAGAAGGTCAGAATGG + Intergenic
1055394204 9:75856432-75856454 ATGAGGAAACTGGCTTAGAGAGG - Intergenic
1055553710 9:77454632-77454654 CTAAAGAAACAGTCTCAGAATGG - Intronic
1055602243 9:77931763-77931785 ATGAAGAAGCAGGCTTAGAGAGG - Intronic
1055670311 9:78598352-78598374 ATTATGAAACATGCTCCGAAAGG + Intergenic
1055671452 9:78610595-78610617 ATGAGGAAATAGACTCGGAAAGG + Intergenic
1056069436 9:82970531-82970553 ATAAAGAAACAGGCTTAGCCGGG - Intergenic
1056271631 9:84953423-84953445 GTGAGGAAACAGGCCCAGAGAGG + Intronic
1056586222 9:87929104-87929126 AAGTAGAAGCAGGTTCAGAAGGG - Intergenic
1056588005 9:87940769-87940791 ATGAAGAAACAACCAGAGAATGG - Intergenic
1056608862 9:88112176-88112198 ATGAAGAAACAACCAGAGAATGG + Intergenic
1056610660 9:88123839-88123861 AAGTAGAAGCAGGTTCAGAAGGG + Intergenic
1057109534 9:92454747-92454769 GTGAGGAAGCAGGCTCAGAGAGG + Intronic
1057237424 9:93373355-93373377 ATGAAGCAACAGGTTCACATGGG + Intergenic
1057313751 9:93956530-93956552 GTAAGGAAACAGGCCCAGAAAGG - Intergenic
1057418914 9:94892472-94892494 TGGAAGAAGCAGGCCCAGAAAGG + Intronic
1057676033 9:97136811-97136833 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1057825025 9:98366117-98366139 ATGAGGAAACTGGTTCAGAGTGG - Intronic
1057900970 9:98947959-98947981 ATGGGAAAACAGGCTCAGAGTGG - Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058038834 9:100282476-100282498 AGGAAGAAAGAGTTTCAGAAGGG + Intronic
1058105301 9:100963720-100963742 GTGAAGAAACAGGTTCACATGGG - Intergenic
1058463420 9:105204755-105204777 ATGCAGGAACAGGAGCAGAAAGG - Intergenic
1058479786 9:105380154-105380176 ATGGAAAAACAGGCTCAGAATGG + Intronic
1058558927 9:106203332-106203354 AGGAAGAAACCAGCACAGAAAGG - Intergenic
1058581129 9:106458883-106458905 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
1058581821 9:106466910-106466932 ATGAAGAAACAGATTAAGTAAGG + Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058637682 9:107052347-107052369 ATGAAGAAACAGAGGCACAATGG + Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1058752882 9:108056168-108056190 ATGAGCAAACAGGCCCAGAGAGG + Intergenic
1058802001 9:108553396-108553418 ATGAAGAAATAGGCTTTGACAGG + Intergenic
1058846172 9:108961736-108961758 ATAAAGAAACAAACTCAAAAGGG + Intronic
1059206331 9:112469782-112469804 ATGAGGAAACAGACTCAAAAAGG - Intronic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059377925 9:113900472-113900494 ATGAGTAAACAGGCACAGAGAGG + Intronic
1059378183 9:113901961-113901983 ATGCAAAAACAGGCCCAAAAAGG - Intronic
1059384902 9:113956993-113957015 ATGAAGAAACTGAGTCACAAAGG + Intronic
1059439599 9:114299570-114299592 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1059758983 9:117320511-117320533 ATGAGGAAATAGGTTCAGAGAGG + Intronic
1059780914 9:117526262-117526284 ATGAGGAAACAGGTTCAAAGAGG + Intergenic
1059825240 9:118020799-118020821 ATGAGGAAACAGGTTCAAAATGG - Intergenic
1059939006 9:119339695-119339717 ATGAGGAAACAAGCTCAGAGAGG + Intronic
1059969157 9:119647238-119647260 ATGAGAAAACAAGCTCAGAGAGG + Intergenic
1059980300 9:119764225-119764247 ATGAGGAGACTAGCTCAGAAAGG - Intergenic
1060027074 9:120182357-120182379 ATGAGGAAACAGACTCACATAGG - Intergenic
1060048270 9:120358419-120358441 ATGAGGAAACAGACCCAGAGAGG + Intergenic
1060060727 9:120457149-120457171 ATGAAGAAATGGGCTCATAAAGG + Intronic
1060066045 9:120501971-120501993 ATGAGGAAACAGGCTGAGACAGG + Intronic
1060069968 9:120537663-120537685 ATGATGAAACAGGCACAGTGTGG - Intronic
1060128862 9:121075674-121075696 ATGAGGAAACATGATCAGGAAGG - Intronic
1060173147 9:121478061-121478083 ATGAAAACAGAGGCTCAGAAAGG + Intergenic
1060188543 9:121578141-121578163 CTGAAAGAAGAGGCTCAGAAGGG - Intronic
1060208700 9:121697924-121697946 ATGAAGAAGCTTGCTCAGACAGG - Intronic
1060237507 9:121876078-121876100 ATTAGGAAACAGGCCCAGAGAGG + Intronic
1060239642 9:121891721-121891743 CTGAGGATACAGGCTCAGAGAGG + Intronic
1060276128 9:122184159-122184181 ATGAGGAAACAGGCTCAGTGGGG + Intronic
1060279260 9:122204951-122204973 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1060451365 9:123743832-123743854 TTAAGGAAACAGGCTCAGAAAGG + Intronic
1060458469 9:123824170-123824192 CAGAAGAAACAGGCTCAGAGAGG + Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060590007 9:124810687-124810709 ACGAGGAGACAGGCTCAGAGAGG + Exonic
1060629816 9:125145665-125145687 ATGAGGAAATAGGCTTAGAGAGG - Intergenic
1060872700 9:127055599-127055621 ATGAGGAAACAGACACAGAAAGG + Intronic
1060900977 9:127258012-127258034 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1060902440 9:127271864-127271886 ATTAAGAAACAAGCTTAAAAAGG - Intronic
1060920511 9:127417500-127417522 ATGAAGAAACAGGCCGAGAGGGG - Intergenic
1061001592 9:127905781-127905803 ATGACAAAACAGGCCCAGAGAGG + Intergenic
1061035957 9:128114483-128114505 ACAAACAAACAGGCTCAGAGAGG - Intergenic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061106282 9:128533131-128533153 ATGATGAAACAGGCTGGGCATGG + Intronic
1061147536 9:128808676-128808698 ATGAGGAGACTGGCTCAGCAAGG + Exonic
1061290168 9:129646269-129646291 ACAAAGAAACGGGCTCAGAGAGG + Intergenic
1061316779 9:129801365-129801387 ATGAAGAATCAGGCAGAGACTGG - Intergenic
1061376176 9:130226172-130226194 GTGAAGAAACATGCCCAGAGAGG + Intronic
1061379246 9:130244182-130244204 ATGAGGAAACAGCTTCAGAGAGG + Intergenic
1061485551 9:130918838-130918860 AGAGAGAAACAGACTCAGAAAGG - Intronic
1061490702 9:130942368-130942390 ATGAGGAAACTGATTCAGAAAGG + Intergenic
1061626041 9:131841319-131841341 ATGAGACAACAGGCTCAGAGAGG - Intergenic
1061648245 9:132024153-132024175 ATAAAGAAAGTGGCTCAGAAGGG - Intronic
1061684759 9:132266227-132266249 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1061937620 9:133866992-133867014 TTGAGGAAACAGGCTCAGGGAGG - Intronic
1185819100 X:3184614-3184636 ATGAGGACACAGGCTCAGTTGGG + Intergenic
1186343899 X:8671065-8671087 ATGATGAAGAAGGCTGAGAATGG - Intronic
1186780023 X:12903175-12903197 AGGAGGAAACAGGCTCATAAAGG - Intergenic
1186890313 X:13953429-13953451 ATGAGGAAACAGGCTCAAAGGGG - Intergenic
1186923519 X:14307334-14307356 ATAATGAAATAGGCTGAGAAAGG - Intergenic
1187153655 X:16704255-16704277 ATGAAGGAATAGGCACAGAAAGG - Intronic
1187206670 X:17188090-17188112 CTAAGAAAACAGGCTCAGAAAGG - Intergenic
1187441332 X:19323318-19323340 ATGAAGAAACAGGCACATGGGGG - Intergenic
1187599764 X:20815056-20815078 AGGCAGAAATAGGGTCAGAAAGG + Intergenic
1187862601 X:23696583-23696605 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1187898291 X:24003211-24003233 ATAAGGAAACAGGCACAGAAAGG - Intronic
1188323192 X:28765944-28765966 ATGCAGAAACACTCTCAGAGGGG - Intronic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1188690113 X:33118890-33118912 GTGAAGAAGCATGCTGAGAAAGG - Intronic
1189141905 X:38616003-38616025 ATGCAGAAACAGGCCCAGAGAGG - Intronic
1189268515 X:39734383-39734405 ATGATAAAACAGGTTCAGAGAGG - Intergenic
1189279705 X:39812531-39812553 GGGAGGAAACAGGCTCGGAAGGG + Intergenic
1189290191 X:39879417-39879439 ATGAAGAAACAAGCCACGAAGGG - Intergenic
1190119467 X:47648802-47648824 ATGAAGAAAAAGGCACAGAGAGG + Intronic
1190524878 X:51318782-51318804 GTGAATACACAGGCTCAGAGGGG + Intergenic
1190545356 X:51520125-51520147 GTGAATACACAGGCTCAGAAAGG - Intergenic
1190689105 X:52898882-52898904 ATGAGGTAACAGGATCAGAGAGG - Intronic
1190696878 X:52956910-52956932 ATGAGGTAACAGGATCAGAGAGG + Intronic
1190756996 X:53409795-53409817 ATGAGGAAACAGGTACAGAAAGG - Intronic
1191020383 X:55853444-55853466 AAAAAGAAACAGGTTCAGTAAGG + Intergenic
1191021189 X:55862135-55862157 ATTAAGAAACAAGCTCAGAGAGG - Intergenic
1191175401 X:57494884-57494906 ATGACAAAACAGGCTGAGATTGG - Intergenic
1191688971 X:63920703-63920725 ATGGGGAAACAGGATCAGACAGG - Intergenic
1191765051 X:64689204-64689226 ATAAAGAATCAGGCTCAGGAGGG + Intergenic
1191845534 X:65544886-65544908 TTGAGGAAACAGACTTAGAAGGG - Intergenic
1191853457 X:65603435-65603457 ATGAAAGGACAGGCTCAGATAGG + Intronic
1191900103 X:66032108-66032130 AAGAGGAAACAGAGTCAGAAAGG - Intronic
1192087131 X:68111519-68111541 ATGACCAAACAGACTCAGAGAGG + Intronic
1192538113 X:71945901-71945923 TTGGGGAAACAGGCTCAGAGGGG + Intergenic
1192627453 X:72745094-72745116 ATAAGAAAACAGGCTTAGAAAGG - Intergenic
1192654255 X:72975719-72975741 ATAAGAAAACAGGCTTAGAAAGG + Intergenic
1193010754 X:76672078-76672100 ATGAAAAAACCAGCTCAAAAAGG + Intergenic
1193184544 X:78496638-78496660 ATGAATAGACAGGATTAGAAAGG + Intergenic
1193384455 X:80854285-80854307 ATGAAGAAAGAGGCTGGGCATGG - Intergenic
1193913451 X:87334741-87334763 GTGAAGAAACAACCTTAGAATGG - Intergenic
1194751479 X:97689561-97689583 AGGATGAACCAGACTCAGAATGG + Intergenic
1194949044 X:100102878-100102900 CTGAGTAAACAAGCTCAGAAAGG - Intergenic
1195135488 X:101903278-101903300 TCCAAGAAACATGCTCAGAAAGG + Intronic
1195135546 X:101904071-101904093 ATGAGGAGATTGGCTCAGAAAGG - Intronic
1195385151 X:104307004-104307026 ATGGGAAAACAGGCTCAGAGTGG - Intergenic
1195405076 X:104503776-104503798 ATAAAGAAATAGGCTAATAAGGG - Intergenic
1195433941 X:104820912-104820934 AAAAAGAAACAGGCTAATAATGG - Intronic
1195510492 X:105710737-105710759 ATTTAGAAACAGGCTCAGATAGG - Intronic
1195679548 X:107534073-107534095 ATGATGAAACAGGTCCAGAATGG - Intronic
1195781016 X:108464183-108464205 ATGAAGAAAGGGGATCAGGAAGG - Intronic
1195921839 X:109991398-109991420 ATGAGGAAAAAGGCTCTGAGAGG + Intergenic
1196002537 X:110802204-110802226 ATAAGGAAACAAGCTCAGAAAGG - Intergenic
1196007899 X:110854951-110854973 ATAAGGAAACAGGCTTAGAGAGG - Intergenic
1196023016 X:111010099-111010121 AGGAAGAAACAGTTTCAGATGGG - Intronic
1196032889 X:111110276-111110298 ATGAAGAAATAGCTTCAGAGGGG + Intronic
1196045991 X:111257026-111257048 ATGAGGAAGCAAGCTCAGAGAGG + Intronic
1196064865 X:111453045-111453067 ATGAAGAAATAAGCTCTGAGAGG + Intergenic
1196402636 X:115332284-115332306 ATGAAGAAACAAGCTTATAGAGG - Intergenic
1196575828 X:117317881-117317903 ATGAAGAAAAGGGCACAGAAAGG + Intergenic
1197188076 X:123610545-123610567 GTGAAGAAACAGACTCTGAGAGG - Intronic
1197705134 X:129629501-129629523 ATGAAGAAACAGATGCAGAGAGG + Intergenic
1197735437 X:129847380-129847402 ATGAAGAAATAGTCTCAGAAAGG - Intergenic
1197841328 X:130750246-130750268 ATGAACAAAGAGGCACAGAGAGG - Intronic
1197962435 X:132022018-132022040 ATGAAGAAAAAGGCTCAACCAGG - Intergenic
1198056302 X:132998915-132998937 GTGAAGAAACAGGCCCAGAAAGG + Intergenic
1198107133 X:133472709-133472731 ATAAAGAAACAGGGTGAGAGTGG + Intergenic
1198295864 X:135285703-135285725 ATTTGGAAACAGGCTTAGAACGG + Intronic
1198377066 X:136050725-136050747 AGGAAGAGACAGGCTCAGGCAGG - Intergenic
1198522362 X:137465854-137465876 ATGAGGAAACAGAGTCAGAGAGG + Intergenic
1198551114 X:137745847-137745869 AGGCAGAAACAGGCTGAGAGAGG + Intergenic
1198604973 X:138327312-138327334 ATGAAGTAATAGACTCAGAGGGG + Intergenic
1198641878 X:138765112-138765134 ATGAAGAAAGAGGCTCAGTGAGG - Intronic
1198684278 X:139211256-139211278 ATGAGGAAACAAGCTCAGAGAGG + Intronic
1198783803 X:140265746-140265768 ATGAGAAAACAGGCTCAGTGAGG - Intergenic
1198971079 X:142280945-142280967 ATGAAGAATGATGATCAGAAAGG - Intergenic
1199802855 X:151268566-151268588 ATGAAGAGAGGGGCTGAGAATGG + Intergenic
1199828426 X:151523933-151523955 ATGATAAATCAGGCTAAGAAAGG + Intergenic
1199914407 X:152323251-152323273 ACAAAAAAACATGCTCAGAATGG - Intronic
1199967599 X:152832751-152832773 AATGAGAAACAGGCTCAGAGAGG - Intronic