ID: 1022526354

View in Genome Browser
Species Human (GRCh38)
Location 7:31040114-31040136
Sequence TTGGATTCTCTGTAAATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022526342_1022526354 22 Left 1022526342 7:31040069-31040091 CCACCCCTCCAAAAAAAAAATGT No data
Right 1022526354 7:31040114-31040136 TTGGATTCTCTGTAAATAATGGG No data
1022526341_1022526354 23 Left 1022526341 7:31040068-31040090 CCCACCCCTCCAAAAAAAAAATG No data
Right 1022526354 7:31040114-31040136 TTGGATTCTCTGTAAATAATGGG No data
1022526343_1022526354 19 Left 1022526343 7:31040072-31040094 CCCCTCCAAAAAAAAAATGTTTA No data
Right 1022526354 7:31040114-31040136 TTGGATTCTCTGTAAATAATGGG No data
1022526344_1022526354 18 Left 1022526344 7:31040073-31040095 CCCTCCAAAAAAAAAATGTTTAC No data
Right 1022526354 7:31040114-31040136 TTGGATTCTCTGTAAATAATGGG No data
1022526345_1022526354 17 Left 1022526345 7:31040074-31040096 CCTCCAAAAAAAAAATGTTTACA No data
Right 1022526354 7:31040114-31040136 TTGGATTCTCTGTAAATAATGGG No data
1022526347_1022526354 14 Left 1022526347 7:31040077-31040099 CCAAAAAAAAAATGTTTACAGGA No data
Right 1022526354 7:31040114-31040136 TTGGATTCTCTGTAAATAATGGG No data
1022526340_1022526354 27 Left 1022526340 7:31040064-31040086 CCATCCCACCCCTCCAAAAAAAA No data
Right 1022526354 7:31040114-31040136 TTGGATTCTCTGTAAATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022526354 Original CRISPR TTGGATTCTCTGTAAATAAT GGG Intergenic
No off target data available for this crispr