ID: 1022527334

View in Genome Browser
Species Human (GRCh38)
Location 7:31046818-31046840
Sequence TGACAGCCTGAGCCCTGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022527334_1022527339 10 Left 1022527334 7:31046818-31046840 CCGAGTCAGGGCTCAGGCTGTCA No data
Right 1022527339 7:31046851-31046873 ATTATCCTGAGCTGCTTTTCTGG No data
1022527334_1022527340 11 Left 1022527334 7:31046818-31046840 CCGAGTCAGGGCTCAGGCTGTCA No data
Right 1022527340 7:31046852-31046874 TTATCCTGAGCTGCTTTTCTGGG No data
1022527334_1022527342 16 Left 1022527334 7:31046818-31046840 CCGAGTCAGGGCTCAGGCTGTCA No data
Right 1022527342 7:31046857-31046879 CTGAGCTGCTTTTCTGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022527334 Original CRISPR TGACAGCCTGAGCCCTGACT CGG (reversed) Intergenic
No off target data available for this crispr