ID: 1022527340

View in Genome Browser
Species Human (GRCh38)
Location 7:31046852-31046874
Sequence TTATCCTGAGCTGCTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022527334_1022527340 11 Left 1022527334 7:31046818-31046840 CCGAGTCAGGGCTCAGGCTGTCA No data
Right 1022527340 7:31046852-31046874 TTATCCTGAGCTGCTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022527340 Original CRISPR TTATCCTGAGCTGCTTTTCT GGG Intergenic
No off target data available for this crispr