ID: 1022527495

View in Genome Browser
Species Human (GRCh38)
Location 7:31048028-31048050
Sequence AAATGATTTGTTCTGTTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022527495_1022527504 27 Left 1022527495 7:31048028-31048050 CCCCATAACAGAACAAATCATTT No data
Right 1022527504 7:31048078-31048100 CTGTGAAAGGGGGTGGTAAATGG No data
1022527495_1022527500 15 Left 1022527495 7:31048028-31048050 CCCCATAACAGAACAAATCATTT No data
Right 1022527500 7:31048066-31048088 CATTTTCTTCATCTGTGAAAGGG 0: 2
1: 103
2: 913
3: 4131
4: 11155
1022527495_1022527501 16 Left 1022527495 7:31048028-31048050 CCCCATAACAGAACAAATCATTT No data
Right 1022527501 7:31048067-31048089 ATTTTCTTCATCTGTGAAAGGGG No data
1022527495_1022527499 14 Left 1022527495 7:31048028-31048050 CCCCATAACAGAACAAATCATTT No data
Right 1022527499 7:31048065-31048087 TCATTTTCTTCATCTGTGAAAGG No data
1022527495_1022527502 17 Left 1022527495 7:31048028-31048050 CCCCATAACAGAACAAATCATTT No data
Right 1022527502 7:31048068-31048090 TTTTCTTCATCTGTGAAAGGGGG No data
1022527495_1022527503 20 Left 1022527495 7:31048028-31048050 CCCCATAACAGAACAAATCATTT No data
Right 1022527503 7:31048071-31048093 TCTTCATCTGTGAAAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022527495 Original CRISPR AAATGATTTGTTCTGTTATG GGG (reversed) Intergenic
No off target data available for this crispr