ID: 1022527498

View in Genome Browser
Species Human (GRCh38)
Location 7:31048063-31048085
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022527498_1022527504 -8 Left 1022527498 7:31048063-31048085 CCTCATTTTCTTCATCTGTGAAA No data
Right 1022527504 7:31048078-31048100 CTGTGAAAGGGGGTGGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022527498 Original CRISPR TTTCACAGATGAAGAAAATG AGG (reversed) Intergenic
No off target data available for this crispr