ID: 1022527504

View in Genome Browser
Species Human (GRCh38)
Location 7:31048078-31048100
Sequence CTGTGAAAGGGGGTGGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022527497_1022527504 25 Left 1022527497 7:31048030-31048052 CCATAACAGAACAAATCATTTCT No data
Right 1022527504 7:31048078-31048100 CTGTGAAAGGGGGTGGTAAATGG No data
1022527495_1022527504 27 Left 1022527495 7:31048028-31048050 CCCCATAACAGAACAAATCATTT No data
Right 1022527504 7:31048078-31048100 CTGTGAAAGGGGGTGGTAAATGG No data
1022527498_1022527504 -8 Left 1022527498 7:31048063-31048085 CCTCATTTTCTTCATCTGTGAAA No data
Right 1022527504 7:31048078-31048100 CTGTGAAAGGGGGTGGTAAATGG No data
1022527496_1022527504 26 Left 1022527496 7:31048029-31048051 CCCATAACAGAACAAATCATTTC No data
Right 1022527504 7:31048078-31048100 CTGTGAAAGGGGGTGGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022527504 Original CRISPR CTGTGAAAGGGGGTGGTAAA TGG Intergenic
No off target data available for this crispr