ID: 1022528156

View in Genome Browser
Species Human (GRCh38)
Location 7:31051754-31051776
Sequence TGGTGGTGCTTACAGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022528156_1022528170 7 Left 1022528156 7:31051754-31051776 CCTCTGTCCTGTAAGCACCACCA No data
Right 1022528170 7:31051784-31051806 CCTGGTCTTTCTCCGGGGGCGGG No data
1022528156_1022528172 9 Left 1022528156 7:31051754-31051776 CCTCTGTCCTGTAAGCACCACCA No data
Right 1022528172 7:31051786-31051808 TGGTCTTTCTCCGGGGGCGGGGG No data
1022528156_1022528173 10 Left 1022528156 7:31051754-31051776 CCTCTGTCCTGTAAGCACCACCA No data
Right 1022528173 7:31051787-31051809 GGTCTTTCTCCGGGGGCGGGGGG No data
1022528156_1022528161 0 Left 1022528156 7:31051754-31051776 CCTCTGTCCTGTAAGCACCACCA No data
Right 1022528161 7:31051777-31051799 TCCCCTTCCTGGTCTTTCTCCGG No data
1022528156_1022528167 3 Left 1022528156 7:31051754-31051776 CCTCTGTCCTGTAAGCACCACCA No data
Right 1022528167 7:31051780-31051802 CCTTCCTGGTCTTTCTCCGGGGG No data
1022528156_1022528177 23 Left 1022528156 7:31051754-31051776 CCTCTGTCCTGTAAGCACCACCA No data
Right 1022528177 7:31051800-31051822 GGGCGGGGGGGTCACATTGGAGG No data
1022528156_1022528176 20 Left 1022528156 7:31051754-31051776 CCTCTGTCCTGTAAGCACCACCA No data
Right 1022528176 7:31051797-31051819 CGGGGGCGGGGGGGTCACATTGG No data
1022528156_1022528174 11 Left 1022528156 7:31051754-31051776 CCTCTGTCCTGTAAGCACCACCA No data
Right 1022528174 7:31051788-31051810 GTCTTTCTCCGGGGGCGGGGGGG No data
1022528156_1022528168 6 Left 1022528156 7:31051754-31051776 CCTCTGTCCTGTAAGCACCACCA No data
Right 1022528168 7:31051783-31051805 TCCTGGTCTTTCTCCGGGGGCGG No data
1022528156_1022528171 8 Left 1022528156 7:31051754-31051776 CCTCTGTCCTGTAAGCACCACCA No data
Right 1022528171 7:31051785-31051807 CTGGTCTTTCTCCGGGGGCGGGG No data
1022528156_1022528163 1 Left 1022528156 7:31051754-31051776 CCTCTGTCCTGTAAGCACCACCA No data
Right 1022528163 7:31051778-31051800 CCCCTTCCTGGTCTTTCTCCGGG No data
1022528156_1022528165 2 Left 1022528156 7:31051754-31051776 CCTCTGTCCTGTAAGCACCACCA No data
Right 1022528165 7:31051779-31051801 CCCTTCCTGGTCTTTCTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022528156 Original CRISPR TGGTGGTGCTTACAGGACAG AGG (reversed) Intergenic