ID: 1022529245

View in Genome Browser
Species Human (GRCh38)
Location 7:31056907-31056929
Sequence AGCGCCCCCTGGATGGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022529245_1022529253 20 Left 1022529245 7:31056907-31056929 CCCAAATCCATCCAGGGGGCGCT 0: 1
1: 0
2: 0
3: 7
4: 49
Right 1022529253 7:31056950-31056972 TCGTGTGTCTTGCCTGTGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 156
1022529245_1022529251 -6 Left 1022529245 7:31056907-31056929 CCCAAATCCATCCAGGGGGCGCT 0: 1
1: 0
2: 0
3: 7
4: 49
Right 1022529251 7:31056924-31056946 GGCGCTCATCCAGGTTTTCTGGG 0: 1
1: 0
2: 0
3: 11
4: 93
1022529245_1022529255 29 Left 1022529245 7:31056907-31056929 CCCAAATCCATCCAGGGGGCGCT 0: 1
1: 0
2: 0
3: 7
4: 49
Right 1022529255 7:31056959-31056981 TTGCCTGTGCCAGGTGCTGTGGG 0: 1
1: 0
2: 2
3: 34
4: 355
1022529245_1022529254 28 Left 1022529245 7:31056907-31056929 CCCAAATCCATCCAGGGGGCGCT 0: 1
1: 0
2: 0
3: 7
4: 49
Right 1022529254 7:31056958-31056980 CTTGCCTGTGCCAGGTGCTGTGG 0: 1
1: 1
2: 12
3: 68
4: 726
1022529245_1022529250 -7 Left 1022529245 7:31056907-31056929 CCCAAATCCATCCAGGGGGCGCT 0: 1
1: 0
2: 0
3: 7
4: 49
Right 1022529250 7:31056923-31056945 GGGCGCTCATCCAGGTTTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022529245 Original CRISPR AGCGCCCCCTGGATGGATTT GGG (reversed) Intronic
905865722 1:41375574-41375596 AGGGCCCACAGGATGGATTCTGG - Intronic
909120126 1:71592776-71592798 AGAGGCCCCTGGAAGCATTTTGG + Intronic
910549384 1:88458604-88458626 AGAACCCAGTGGATGGATTTGGG + Intergenic
912872632 1:113323670-113323692 AGCACCACCAGAATGGATTTTGG - Intergenic
915339414 1:155168040-155168062 AGCGCCCCCTGCAGGCGTTTTGG + Intergenic
915633224 1:157168056-157168078 AGAGCCTCATGGATGGAATTAGG + Intergenic
1065133230 10:22643590-22643612 AGAGCCCCATGGAGGGATTTGGG - Intronic
1069800996 10:71081386-71081408 GGCGTCCCCTGGGTGTATTTGGG - Intergenic
1074191267 10:111139641-111139663 AGTGTCCCCTGGATGCATTAGGG - Intergenic
1077041817 11:528157-528179 AGGCCTCCCTGGATGGATGTTGG + Intergenic
1077531053 11:3095090-3095112 AGCCCCCTCTGGAGGGATTTGGG - Intronic
1087100174 11:94355908-94355930 AGAGATCCCTGGATGGATCTCGG + Intergenic
1092960383 12:13591340-13591362 AGCGAACCCTGGGTGGATGTAGG + Intronic
1103825394 12:123733737-123733759 AGCGCTCCGTGGATTGGTTTGGG + Intronic
1104783870 12:131437597-131437619 AGCTCCACCTGGAATGATTTGGG + Intergenic
1122414115 14:101540677-101540699 AGCGGCCCCAGGATGGGGTTGGG + Intergenic
1137607567 16:49796736-49796758 AGTGGCCCCAGCATGGATTTTGG - Intronic
1147884287 17:43674362-43674384 AGCACCCCCTCCATGGTTTTAGG - Intergenic
1157321178 18:46635878-46635900 AGAGCCCCCTAGATGGATTGAGG + Intronic
1161270816 19:3388254-3388276 AGCGCTTCCTGGATGGAATTGGG + Intronic
1165466416 19:35977596-35977618 AGCGCCCCCTGCATGGAGGGTGG + Intergenic
1166919935 19:46222239-46222261 AGCGCCCCCAGGAAGGACCTAGG + Intergenic
1167098831 19:47391610-47391632 AGCGCCCCCTGGAGGGATGCAGG + Intergenic
1167185440 19:47939402-47939424 GGCGCCCCCTGGAGGGATGAAGG - Intergenic
1168358864 19:55721449-55721471 AGAGCCCCTGGGTTGGATTTAGG + Intronic
926243242 2:11103779-11103801 AGCCTCCCCTGGATGGGATTTGG + Intergenic
935143973 2:100381359-100381381 AGCGCCCCCTGGAGGAACATGGG + Intergenic
936473094 2:112816116-112816138 AGGCTCCACTGGATGGATTTAGG - Intergenic
938107565 2:128543775-128543797 AGATCCCCCTGGATGGCCTTAGG - Intergenic
948237667 2:236402581-236402603 AGCTCCCCCTGCATGGTTTATGG - Intronic
948565353 2:238882912-238882934 TGTGCCCCCTGGATGGATGTAGG + Intronic
1173945079 20:46944097-46944119 TGCTCCCCCTGGATGGCTCTGGG + Intronic
1175794107 20:61760580-61760602 AGTGCCCCCAGGATGGAGTAGGG - Intronic
1178962864 21:37083813-37083835 AACCCCGCCTGGAAGGATTTGGG + Exonic
1184419784 22:44372998-44373020 AGAGCGCCCTGGAGGGGTTTGGG - Intergenic
1184630137 22:45770941-45770963 AGTGCTCCCAGGATGGATCTGGG - Intronic
950115639 3:10448906-10448928 AGCCCACAGTGGATGGATTTGGG - Intronic
955957966 3:64309906-64309928 TGCACCCCCTGGAGGGATTTTGG - Intronic
962241912 3:133757042-133757064 AGTGCTCCCTGCTTGGATTTGGG + Intronic
969671709 4:8593414-8593436 TGGGCCCCCTGGAGGGATCTGGG + Intronic
969857085 4:10008675-10008697 AGCGGCCTCTGGATGGAGTCTGG + Intronic
991122408 5:63031805-63031827 AGCTTCCCCTAGATGGATTCAGG + Intergenic
996640219 5:125743011-125743033 ACCGCAACCTGGATGGAATTGGG + Intergenic
999378083 5:151100955-151100977 AGCGCGGCCTGGATGGAGATGGG + Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1003244704 6:4374091-4374113 GTAGCCCCATGGATGGATTTGGG + Intergenic
1008386066 6:50891911-50891933 ATAGTCCCCTGGATTGATTTTGG - Intergenic
1016290674 6:142525530-142525552 AGAGCCCCTGGGATGAATTTGGG + Intergenic
1016508559 6:144813635-144813657 ATCGCCACCTGGATTTATTTTGG - Intronic
1019758982 7:2794968-2794990 AGCGCACTCTGGAGGGATTCTGG - Exonic
1022529245 7:31056907-31056929 AGCGCCCCCTGGATGGATTTGGG - Intronic
1026304345 7:69127068-69127090 AGAGCCTGCTGGATGGAGTTTGG + Intergenic
1042804982 8:72761217-72761239 AGGGCCCCCAGGATGGATGCAGG - Intronic
1047297778 8:123586597-123586619 AGTGACATCTGGATGGATTTAGG - Intergenic
1059500236 9:114746186-114746208 AGTGCCCCCAGGATGGATGCAGG - Intergenic
1190278973 X:48917391-48917413 AGCGCCCCCTGGCGGGCTCTAGG - Intronic
1197173733 X:123462663-123462685 AGCCCCCCCTGGAATTATTTGGG + Intronic