ID: 1022529319

View in Genome Browser
Species Human (GRCh38)
Location 7:31057278-31057300
Sequence GTGCACTCCCTGACTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 215}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022529304_1022529319 13 Left 1022529304 7:31057242-31057264 CCTTCTTCCTCCCCCTCCTCTTA 0: 1
1: 4
2: 52
3: 597
4: 3466
Right 1022529319 7:31057278-31057300 GTGCACTCCCTGACTCCTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 215
1022529316_1022529319 -10 Left 1022529316 7:31057265-31057287 CCTGGCCCAGGGGGTGCACTCCC 0: 1
1: 0
2: 4
3: 26
4: 278
Right 1022529319 7:31057278-31057300 GTGCACTCCCTGACTCCTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 215
1022529312_1022529319 0 Left 1022529312 7:31057255-31057277 CCTCCTCTTACCTGGCCCAGGGG 0: 1
1: 0
2: 4
3: 33
4: 326
Right 1022529319 7:31057278-31057300 GTGCACTCCCTGACTCCTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 215
1022529302_1022529319 30 Left 1022529302 7:31057225-31057247 CCCGCATTTATCTTCTGCCTTCT 0: 1
1: 0
2: 4
3: 56
4: 508
Right 1022529319 7:31057278-31057300 GTGCACTCCCTGACTCCTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 215
1022529303_1022529319 29 Left 1022529303 7:31057226-31057248 CCGCATTTATCTTCTGCCTTCTT 0: 1
1: 1
2: 10
3: 94
4: 827
Right 1022529319 7:31057278-31057300 GTGCACTCCCTGACTCCTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 215
1022529307_1022529319 3 Left 1022529307 7:31057252-31057274 CCCCCTCCTCTTACCTGGCCCAG 0: 1
1: 0
2: 4
3: 49
4: 537
Right 1022529319 7:31057278-31057300 GTGCACTCCCTGACTCCTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 215
1022529308_1022529319 2 Left 1022529308 7:31057253-31057275 CCCCTCCTCTTACCTGGCCCAGG 0: 1
1: 2
2: 4
3: 44
4: 433
Right 1022529319 7:31057278-31057300 GTGCACTCCCTGACTCCTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 215
1022529310_1022529319 1 Left 1022529310 7:31057254-31057276 CCCTCCTCTTACCTGGCCCAGGG 0: 1
1: 1
2: 3
3: 58
4: 434
Right 1022529319 7:31057278-31057300 GTGCACTCCCTGACTCCTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 215
1022529306_1022529319 6 Left 1022529306 7:31057249-31057271 CCTCCCCCTCCTCTTACCTGGCC 0: 1
1: 0
2: 4
3: 106
4: 1007
Right 1022529319 7:31057278-31057300 GTGCACTCCCTGACTCCTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 215
1022529315_1022529319 -3 Left 1022529315 7:31057258-31057280 CCTCTTACCTGGCCCAGGGGGTG 0: 1
1: 0
2: 0
3: 17
4: 225
Right 1022529319 7:31057278-31057300 GTGCACTCCCTGACTCCTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022529319 Original CRISPR GTGCACTCCCTGACTCCTCC AGG Intronic
900481875 1:2903332-2903354 GAGCACGCGCTGACTCCTCATGG + Intergenic
901613486 1:10518285-10518307 GTCTACTCCCTGCCTCCCCCGGG + Intronic
901686825 1:10947884-10947906 GTGCAACCCCCCACTCCTCCTGG + Exonic
901880198 1:12189207-12189229 CAGCCCTCCCTGACTCCCCCAGG - Intronic
902212212 1:14912346-14912368 GTGACCTCCCTGGCTGCTCCAGG - Intronic
902553603 1:17233775-17233797 CAGCACTGCCTGACTCCTCTGGG - Intronic
902642535 1:17775941-17775963 AAGCCCTCCCTGACTCTTCCAGG - Intronic
903715064 1:25359249-25359271 GTCCATTCCCTGCCTCCTCATGG + Intronic
904206569 1:28859299-28859321 GTGCACTCACTCACTCACCCCGG - Exonic
904521776 1:31101339-31101361 TTGCACACCCTGACCTCTCCTGG - Intergenic
905825027 1:41020750-41020772 GGACACTCCCTGAGTCCTCTGGG - Exonic
906639244 1:47431844-47431866 TTGCCCTCCCTGCCTCATCCTGG + Intergenic
907419615 1:54338126-54338148 CTGCACTCACTGCCTGCTCCAGG + Intronic
907514591 1:54985678-54985700 ATGCACTGCCTGACTTCACCTGG - Intronic
907549165 1:55289479-55289501 GTGTACTCCCTGCTTCCTGCTGG + Intergenic
908389846 1:63674602-63674624 GTGCAGTCTCTGACTCATCAAGG + Intergenic
908696987 1:66854724-66854746 ATGCAATCTCTGCCTCCTCCCGG - Intronic
914841851 1:151254944-151254966 CTGGACTCCCTGAGTCATCCCGG + Intronic
919156980 1:193777745-193777767 ATTCACTCACTGACTCATCCTGG + Intergenic
920511793 1:206557279-206557301 CCTCACTCCCTGACTCGTCCGGG - Intronic
923231366 1:231989569-231989591 ATGCTCTCCCTCACTCCTCTTGG - Intronic
923682919 1:236133525-236133547 GGGCACTCCCTTTCTCCACCTGG + Intergenic
1062845359 10:699160-699182 CTGCTCTCCCTGACTCCTGGAGG + Intergenic
1062856588 10:782875-782897 GTGCCCTCCCTCTCTACTCCTGG + Intergenic
1063120289 10:3101133-3101155 GCACCCTCCCTGGCTCCTCCTGG + Intronic
1063156943 10:3388653-3388675 GTTCAAGCCCTGACTCCTCCAGG + Intergenic
1065916499 10:30358163-30358185 CTGCTCTCCCTGCCTCCCCCAGG + Intronic
1067053518 10:43038531-43038553 GTTCACTTGCTGCCTCCTCCAGG - Intergenic
1067274015 10:44818796-44818818 GTGGCTTTCCTGACTCCTCCAGG - Intergenic
1069753882 10:70761660-70761682 GCTCACTCCCTGACTCCACCAGG + Exonic
1070740507 10:78900193-78900215 CTCCACTCCCGGATTCCTCCTGG + Intergenic
1070866408 10:79710229-79710251 GTGCCCCTCCTGCCTCCTCCGGG + Intronic
1070880201 10:79848360-79848382 GTGCCCCTCCTGCCTCCTCCGGG + Intronic
1070923386 10:80203090-80203112 GTGCACCCCCTCCTTCCTCCTGG - Intronic
1071633317 10:87232450-87232472 GTGCCCCTCCTGCCTCCTCCGGG + Intronic
1071646766 10:87364668-87364690 GTGCCCCTCCTGCCTCCTCCGGG + Intronic
1071890587 10:90002104-90002126 GAGCACCCTCTGACTCCTCAGGG + Intergenic
1073131355 10:101191049-101191071 CTGCACTCCCCGATCCCTCCAGG + Intergenic
1076404789 10:130204587-130204609 GTGCTGACCCTGCCTCCTCCGGG + Intergenic
1076413773 10:130270659-130270681 GCGCACACCCTGCTTCCTCCTGG - Intergenic
1076816748 10:132918828-132918850 GTGCCCTCCCTGACTCCTGCAGG + Intronic
1079091690 11:17485136-17485158 GTGCACTCCCTGGCTGAGCCAGG - Intergenic
1079333751 11:19553544-19553566 GTGCCTTCCCTGGCTCATCCTGG - Intronic
1079627783 11:22635782-22635804 ATGCACTCCCAGACTCCACCGGG - Intronic
1081451976 11:43179729-43179751 GTGCTATCTCTGGCTCCTCCAGG - Intergenic
1083843129 11:65315694-65315716 GTGCGCTCTCGGAGTCCTCCGGG + Intronic
1085314743 11:75537812-75537834 GTGTCCTCGCTGACACCTCCTGG - Intergenic
1087680047 11:101210167-101210189 CTGCACTCCCTGACTCCATGTGG + Intergenic
1089070523 11:115696124-115696146 GTGGACACCCTGCCTCCCCCTGG - Intergenic
1089352254 11:117828374-117828396 GTGGGCTCCTTGATTCCTCCCGG - Intronic
1089376131 11:117996114-117996136 GTTCCCTCCCTGACTCTTCCTGG - Intronic
1089649868 11:119905746-119905768 GTGCATACCCTGACTCCTTCAGG - Intergenic
1090082521 11:123623533-123623555 CAGCACACCCTGACTCATCCTGG - Intronic
1090387836 11:126366810-126366832 GCGCTCACCCTGCCTCCTCCCGG - Intronic
1092890001 12:12960449-12960471 CTGCAACCTCTGACTCCTCCTGG - Intergenic
1095323168 12:40854838-40854860 CTTGACTCCCTGACTCCTCTGGG - Intronic
1095969965 12:47894796-47894818 GTCCACTCCCTTACTCTTGCTGG + Intronic
1096523649 12:52198227-52198249 GTGGTCTGCCTGACTCCTCCAGG - Intergenic
1096789674 12:54036988-54037010 GTGCACTGACTGCCTCCTCCCGG + Intronic
1097318896 12:58203829-58203851 GTGCACTCCCAGACTTATTCTGG + Intergenic
1098239416 12:68451509-68451531 GAGCACTCTCTCACTCCTCCTGG + Intergenic
1099869963 12:88334625-88334647 ATGAACTCCCTGACTCATCTGGG - Intergenic
1100008290 12:89921193-89921215 GTGCACTGCAAAACTCCTCCAGG - Intergenic
1100979484 12:100153576-100153598 CTGCACTCCCTGCTTCCCCCAGG + Intergenic
1104092893 12:125530614-125530636 GTGCTCCCTCTGACGCCTCCAGG + Intronic
1105049653 12:133037392-133037414 GTGCAGTCCCCGACTCGTCCCGG + Intronic
1105897309 13:24727155-24727177 GTCCTCTCCCTCACTCCTTCAGG - Intergenic
1106024148 13:25941081-25941103 GAGAACTTTCTGACTCCTCCAGG + Intronic
1110635978 13:77767442-77767464 GTAAACTTCCTGACTCCTCTTGG - Intergenic
1113306880 13:109088885-109088907 GGGCAGCCCCTCACTCCTCCAGG + Intronic
1113314057 13:109159869-109159891 TTGCATGCCCTGACTCCTGCTGG - Intronic
1113637081 13:111927007-111927029 GTGCATCCCCAGCCTCCTCCTGG - Intergenic
1114714107 14:24806464-24806486 GTGCCCTACCTGGCACCTCCTGG - Intergenic
1118488285 14:66234461-66234483 ATGCCCTCCCTGTCTCCTGCTGG - Intergenic
1121173835 14:91875687-91875709 GTGCTGGCCCTGGCTCCTCCAGG - Intronic
1121935801 14:98017337-98017359 GTACTCTCCATGTCTCCTCCTGG - Intergenic
1122869740 14:104632807-104632829 CAGCCCTGCCTGACTCCTCCCGG + Intergenic
1202902514 14_GL000194v1_random:51740-51762 GTGCCCTCCCTGCCTGCTGCAGG - Intergenic
1124224707 15:27883123-27883145 CTGCTCTCTCTGACTCCTCTGGG + Intronic
1125314737 15:38418969-38418991 GAGGACTCCCTGACTCTTTCAGG - Intergenic
1125520381 15:40345041-40345063 GTGCCCTCCCTCTCTCCACCCGG + Intergenic
1125735353 15:41921261-41921283 CGGCACTCCCTGACTCCTTGGGG + Intronic
1125834695 15:42738552-42738574 GGGCACTGCCTCACCCCTCCTGG - Intergenic
1125894194 15:43288179-43288201 GAGCCCACCCTGGCTCCTCCAGG - Intronic
1126738971 15:51758906-51758928 CTGCACTCCCCATCTCCTCCTGG - Intronic
1127382056 15:58438669-58438691 GTGGGCGCCCTGACTCCTCCAGG - Intronic
1127570262 15:60234738-60234760 GTGCAATTCCTGACAACTCCAGG - Intergenic
1128308360 15:66614814-66614836 GGGGACTCAGTGACTCCTCCAGG - Intronic
1129165030 15:73771967-73771989 GTGCATCCCCTGATTCCCCCAGG + Intergenic
1130282757 15:82532233-82532255 CTGCCCTCCCTGCCTCCCCCAGG - Intergenic
1131325035 15:91434772-91434794 GGGCCTTCCCTGATTCCTCCAGG - Intergenic
1132286124 15:100663788-100663810 GTGCCCTCCCTAAATTCTCCTGG - Intergenic
1132403775 15:101530107-101530129 GTGCACTCCCTGACACCGGTGGG + Intergenic
1132630323 16:914209-914231 GGGCAGTCCCTGACCCCTCCTGG + Intronic
1138083573 16:54114556-54114578 GCACATTCCCTGACTCCACCTGG - Exonic
1139280122 16:65763546-65763568 GGGCCCTCCCTGACTACTTCAGG - Intergenic
1139966481 16:70748341-70748363 GCTCACCACCTGACTCCTCCGGG - Intronic
1140388265 16:74561831-74561853 CTGCACTCCATGACTCATCATGG + Intronic
1141570296 16:84929980-84930002 GGGCTCTCCATGACTCCTCTGGG - Intergenic
1142891776 17:2948516-2948538 GTGCCCTCCCTGCCTCCCCCTGG - Intronic
1142891807 17:2948654-2948676 GTGCCCTCCCTGCCTCCCCCTGG - Intronic
1142891837 17:2948792-2948814 GTGCCCTCCCTGCCTCCCCCTGG - Intronic
1143572035 17:7765369-7765391 CTCCACTCTCTGACTCCCCCAGG + Exonic
1143897362 17:10146421-10146443 ATTCACTCCCTGACTCTTGCGGG - Intronic
1144936159 17:18900819-18900841 GTGGAATTCCTGACTCCACCAGG + Intronic
1145767126 17:27466474-27466496 TTGCACTTCCTGCCTCCTCCTGG + Intronic
1146444718 17:32924162-32924184 ATGCACTCCATGACTCATCATGG + Intergenic
1146916661 17:36682437-36682459 GTTCACTCCTTGTTTCCTCCTGG + Intergenic
1150622885 17:66821793-66821815 ATGCCCTCCCTGGATCCTCCAGG + Intergenic
1151461333 17:74255950-74255972 GTGCACTTCCTGGGTCCTCAGGG - Intronic
1157446540 18:47750791-47750813 GTGGAGACCCTGCCTCCTCCAGG - Intergenic
1160526754 18:79543083-79543105 GTGCTCTCCCTGCCTCACCCCGG + Intergenic
1160557407 18:79735277-79735299 GTGCACCCCCAGATCCCTCCTGG + Intronic
1161096017 19:2391160-2391182 CTGCAATCTCTGCCTCCTCCTGG - Intronic
1161521421 19:4725915-4725937 CTGCACACCCTCACTCCTGCGGG + Intergenic
1162518988 19:11167910-11167932 ATTCACTCCCTAACTTCTCCAGG + Intronic
1162792031 19:13068162-13068184 GTGCAATCCCAGGCTCCTCCTGG + Intronic
1164753413 19:30672232-30672254 CTGCACACACAGACTCCTCCAGG - Intronic
1165603401 19:37078212-37078234 GGGCACTCCCAGAAACCTCCGGG + Intronic
1167242959 19:48356030-48356052 GTGCCGTCCATGACTCCACCGGG + Intronic
926990846 2:18677883-18677905 GTGCACTCCCAGAATCCAGCAGG - Intergenic
927213485 2:20652751-20652773 GTCCACACCCTGGCTCCTGCTGG - Intergenic
929783487 2:44972790-44972812 GCCCACTCCCTGACACTTCCTGG - Intergenic
932813866 2:74845913-74845935 ATGCCCTCACAGACTCCTCCTGG - Intronic
935640501 2:105285525-105285547 TTCCACTCACTGATTCCTCCAGG + Intronic
936885921 2:117309896-117309918 GTGCACTCCCAGTCTCCAGCAGG - Intergenic
937155463 2:119715784-119715806 GTGCACCCCATGTCTCCTGCAGG + Intergenic
937380310 2:121370717-121370739 TGGCACTTCCTGACTCCTCCTGG + Intronic
942141143 2:172978466-172978488 GTGCTCACCCTCAGTCCTCCTGG + Intronic
945259256 2:207829349-207829371 CTGCACCCTCTGCCTCCTCCTGG + Intronic
946385524 2:219382121-219382143 GTGCACTCTCAGACCCCACCTGG + Exonic
949034687 2:241811055-241811077 GTGCACTCACGGAGCCCTCCTGG + Exonic
1170898967 20:20441587-20441609 GAGCACTCCCTCTCTCCTCCTGG + Intronic
1171463072 20:25309660-25309682 GGCCCCTCCCTGTCTCCTCCTGG - Intronic
1175285701 20:57835328-57835350 GTGCACTCCCTGACCTCACTGGG - Intergenic
1175856576 20:62123593-62123615 GTGCACTCCCCGTCTTCTCTGGG - Intronic
1176041203 20:63066773-63066795 GGCCCCTCCCTGACTGCTCCAGG + Intergenic
1176621880 21:9066507-9066529 GTGCCCTCCCTGCCTGCTGCAGG - Intergenic
1178545729 21:33491662-33491684 GTGCCCTGCCTGGGTCCTCCGGG - Intronic
1183364550 22:37400100-37400122 TTGCACTCCCTTGCCCCTCCCGG - Intronic
1183790818 22:40067718-40067740 GTGCATTCTCTGTCTCTTCCAGG - Intronic
1183985926 22:41570406-41570428 GTGGACTCCTGGACTCATCCAGG + Intronic
1184175885 22:42788475-42788497 CTGCCCTCCCTGCCTCCCCCAGG - Intergenic
1184192512 22:42904406-42904428 TTGCTCTCCCTCACTCCTCAGGG + Intronic
1184192912 22:42907009-42907031 GAGCCTTCCCTGACTGCTCCGGG - Intronic
1184636148 22:45833381-45833403 GAGCGCTCCTTGACTCCTCAGGG + Intronic
1185326631 22:50228814-50228836 CTGCGCTGCCTGGCTCCTCCAGG + Intronic
949891360 3:8735860-8735882 AAGCCTTCCCTGACTCCTCCAGG + Intronic
950170705 3:10837362-10837384 TTGCACTCCCTGGCTCCCCAGGG + Intronic
952839321 3:37630827-37630849 GTGTCCTCCCTCACTCCCCCAGG - Intronic
953413191 3:42701590-42701612 GTGCCCTCCCTGGCCCCGCCTGG - Intronic
953730529 3:45443625-45443647 GGGCACTCCCAGCCTCCTCTGGG + Intronic
960950086 3:122993639-122993661 ATGCAATCCCTCTCTCCTCCTGG + Intronic
963073913 3:141328929-141328951 GAGCATTCCCTGAGCCCTCCAGG + Intronic
963923200 3:150925339-150925361 GTGCACCCTCTGTCTCCACCAGG + Intronic
964747159 3:160023215-160023237 GTGTTCTCCCTGAAGCCTCCTGG - Intronic
967131152 3:186471845-186471867 GTACAGTCTGTGACTCCTCCAGG + Intergenic
967853878 3:194101923-194101945 GTGCTCTCCCTTGCTTCTCCAGG - Intergenic
968461976 4:730710-730732 GTGAACTGCCGGACTCCGCCGGG + Intronic
968735441 4:2292786-2292808 GAGCACTCCCCAGCTCCTCCTGG + Intronic
968807647 4:2786256-2786278 GTGCACACCCTCAGCCCTCCTGG - Intergenic
968813245 4:2809354-2809376 GTGCCCTCCCTCCCTCCTCTGGG + Intronic
969079339 4:4606450-4606472 GTGCTCCCCCTGAAACCTCCAGG + Intergenic
970997799 4:22287794-22287816 GTGAGCTCCCTGACTCCCTCTGG - Intergenic
972209725 4:36823025-36823047 ATGCACTCCCAGACTCCAGCAGG + Intergenic
975029716 4:69600296-69600318 GTGCACTCCCAGACTCCAGCAGG + Intronic
982045235 4:151438360-151438382 GTCCACTGCCTGAATCCTGCAGG - Intronic
985717318 5:1469894-1469916 CTGACCTCCCTGCCTCCTCCAGG - Intronic
985867300 5:2524008-2524030 GTGCACACCCTCACTGCCCCAGG - Intergenic
987088049 5:14487745-14487767 GGGCCCTCCCTGCCTCCCCCTGG + Exonic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
991662226 5:68961989-68962011 GTGCACACCCTGCTTCCTGCAGG + Intergenic
994602200 5:101921024-101921046 GTGCACTCCCTGAGGCATCTTGG - Intergenic
999211247 5:149891098-149891120 CTGCACTCCATGACTCATCATGG + Intronic
1002132332 5:177089311-177089333 CTGCTCTCCCTGAGTCCTGCTGG - Intronic
1002582028 5:180214887-180214909 GTGCCCAGCCTGCCTCCTCCTGG - Intergenic
1003356775 6:5380772-5380794 GTCATCTCCCTGACTCATCCTGG + Intronic
1006917412 6:37603402-37603424 GTGCTCTCCATCACCCCTCCAGG + Intergenic
1007374997 6:41450591-41450613 GTGAACTCCCTGAGTGATCCTGG + Intergenic
1007704175 6:43781035-43781057 GTCCCCTCCCTTAATCCTCCAGG - Intronic
1012825910 6:104146119-104146141 GTTGACTCCCTGTCTCATCCTGG - Intergenic
1012978121 6:105801889-105801911 GAGCCCACCCTGACCCCTCCCGG + Intergenic
1017186764 6:151609329-151609351 GTTCACTTCCTGGCTCCTACTGG + Intronic
1019063617 6:169276389-169276411 CTGCACTCCATGACTCATCATGG + Intergenic
1019270891 7:148171-148193 ATGCATTCCATGACTCATCCTGG - Intergenic
1021075940 7:16304782-16304804 GTGAACTCCCTGACTTTTCAGGG + Intronic
1021769320 7:23983112-23983134 GTGCACTCTCAGACTCCAGCAGG + Intergenic
1022529319 7:31057278-31057300 GTGCACTCCCTGACTCCTCCAGG + Intronic
1022591165 7:31664589-31664611 ATGCAGTACCTGAATCCTCCTGG + Intergenic
1023316080 7:38938671-38938693 GTCCACTGCCTGACCCCTCTGGG - Intergenic
1023745763 7:43321034-43321056 TTTCACTCCATGGCTCCTCCGGG + Intronic
1025079128 7:55966939-55966961 TGGCACTCCCTCCCTCCTCCTGG - Intronic
1025791028 7:64686801-64686823 CTGCTCTCCCTCACACCTCCGGG + Intronic
1027190235 7:75992304-75992326 GTGTCCTCCCTGACTCCCACAGG + Intronic
1027249472 7:76389997-76390019 GTGACCTCCCTTCCTCCTCCAGG - Exonic
1032001140 7:128266096-128266118 GGACACTCCCTGCCACCTCCTGG + Intergenic
1032984029 7:137317164-137317186 CTGCTCTCCCTGACTCACCCAGG - Intronic
1034151200 7:148916758-148916780 GAGCCCTCCCTGCCTCTTCCTGG + Intergenic
1037479091 8:19287540-19287562 GTGCATTCCCAGACTCCAGCAGG - Intergenic
1037776830 8:21841086-21841108 GTGCACTCTCTGACCCAGCCAGG + Intergenic
1039330277 8:36530284-36530306 GTCCCCTCCCTGACTCATACTGG + Intergenic
1039816481 8:41099246-41099268 GTGTTCTCCCTGTCTGCTCCAGG + Intergenic
1042427415 8:68664207-68664229 GTACACTCCTTGTCTCCTCAGGG + Intronic
1042737064 8:72001288-72001310 GTGCTGCCCCTGGCTCCTCCAGG - Intronic
1043609568 8:82045570-82045592 TTGCCCTCCCTGACTCTGCCTGG + Intergenic
1043827003 8:84941385-84941407 TTGCATTCCATGACTCATCCTGG + Intergenic
1045049704 8:98311654-98311676 GTGCACACACACACTCCTCCTGG - Intergenic
1047029634 8:120862345-120862367 GTGCAGTCCCAGACTCCAGCGGG - Intergenic
1047525332 8:125628170-125628192 GTGCTCTCTCAGGCTCCTCCTGG - Intergenic
1048833588 8:138497954-138497976 TTCCATTCCCTGCCTCCTCCTGG - Intergenic
1049350349 8:142160947-142160969 GTGGCCTCTGTGACTCCTCCAGG + Intergenic
1049569260 8:143360767-143360789 GTGCTCTCCCAGAGGCCTCCAGG - Intergenic
1049663961 8:143834911-143834933 GTGGGGTCCCTGACGCCTCCAGG + Exonic
1051764996 9:20513746-20513768 ATCCACTCCCTGCCTCCTCCCGG - Intronic
1052851475 9:33380927-33380949 GCTCACTCCCTCACTCCTTCAGG + Intergenic
1053317624 9:37065537-37065559 GAGCCCTCCCTGCCTCTTCCTGG - Intergenic
1055485823 9:76755564-76755586 ATGCCTTCCCTGACTCCTCAAGG - Intronic
1057279135 9:93697947-93697969 GTCCCCTCCCTGACTACTGCGGG + Intergenic
1060547449 9:124469569-124469591 GTGCACTTCCTGCTTCCTGCTGG - Intronic
1060756395 9:126217598-126217620 GTGCAGCCCCAGCCTCCTCCAGG + Intergenic
1060776718 9:126380016-126380038 GTTCACTTTCTGACTCCTTCTGG - Intronic
1060779339 9:126400093-126400115 GTGCACTGCCTCACACCACCAGG + Intronic
1061061751 9:128254105-128254127 CTGCCCTCCCTGCCTCCCCCAGG + Intronic
1061946061 9:133908644-133908666 TTCCACTCCCTGAGTCTTCCTGG - Intronic
1062084022 9:134639366-134639388 GTGCACTGCCTGCCTCCCCATGG - Intergenic
1062352100 9:136144243-136144265 GGGCTGTTCCTGACTCCTCCAGG - Intergenic
1203745068 Un_GL000218v1:36925-36947 GTGCCCTCCCTGCCTGCTGCAGG - Intergenic
1203565040 Un_KI270744v1:82559-82581 GTGCCCTCCCTGCCTGCTGCAGG + Intergenic
1190338790 X:49280049-49280071 GTGCACATCCTGACTCCCCGGGG + Intronic
1191778356 X:64842980-64843002 TTTCACCCCCTCACTCCTCCTGG + Intergenic
1192210302 X:69123582-69123604 CTGCACTGCCTGCCTCCTGCAGG - Intergenic
1194978562 X:100416884-100416906 GTGCTCTCTCTGCCTCCTTCTGG - Intergenic
1197708889 X:129652557-129652579 CTCTACTCCCTGACTTCTCCTGG - Intronic
1197766652 X:130063662-130063684 AAGCCCTCACTGACTCCTCCTGG - Intergenic
1198562637 X:137867322-137867344 GGGCACTCCCTGACTTCCCTGGG - Intergenic
1201158403 Y:11151964-11151986 GTGCCCTCCCTGCCTGCTGCAGG - Intergenic
1202502771 Y:25490220-25490242 CTGCACTCCCTGCCTTCCCCAGG + Intergenic