ID: 1022531585

View in Genome Browser
Species Human (GRCh38)
Location 7:31070192-31070214
Sequence TGCAGAAGGAACGGAGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022531585_1022531595 24 Left 1022531585 7:31070192-31070214 CCCCAGGCTCCGTTCCTTCTGCA 0: 1
1: 0
2: 1
3: 28
4: 272
Right 1022531595 7:31070239-31070261 GCCAGCATCTCCTCTTTGCAGGG No data
1022531585_1022531594 23 Left 1022531585 7:31070192-31070214 CCCCAGGCTCCGTTCCTTCTGCA 0: 1
1: 0
2: 1
3: 28
4: 272
Right 1022531594 7:31070238-31070260 AGCCAGCATCTCCTCTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022531585 Original CRISPR TGCAGAAGGAACGGAGCCTG GGG (reversed) Intronic
900145166 1:1156059-1156081 TGACGAGGGAACGGAGGCTGTGG - Intergenic
900514802 1:3076555-3076577 GGCAGAAGCACTGGAGCCTGGGG + Intronic
900590322 1:3456561-3456583 TGCAGAGGGAATGTGGCCTGCGG - Intronic
900814970 1:4836725-4836747 TGCAGAAGGAGCAAAGCTTGGGG + Intergenic
902555557 1:17244619-17244641 TGCACCTGGAACGGGGCCTGGGG + Exonic
903275937 1:22221885-22221907 TGCAGGAGGAACTGAGACTACGG - Intergenic
904207177 1:28862913-28862935 AGGAGAAGGACCGCAGCCTGCGG + Exonic
905273474 1:36802033-36802055 TGCAGAAGGAACGCTGCAGGAGG + Exonic
906220049 1:44071466-44071488 TGGAGAAGGAAGGGATCATGGGG - Intergenic
907112092 1:51935631-51935653 GGCAGAATGAACAGAGACTGAGG + Intronic
907830829 1:58062614-58062636 TGCACCAGGAACAGAACCTGGGG - Intronic
915547785 1:156611894-156611916 GAAAGAAGGAACAGAGCCTGTGG + Intergenic
917792582 1:178508769-178508791 TGCAGAAGGGCAGAAGCCTGTGG + Intergenic
917817818 1:178727739-178727761 TGCAGAATGAACTGAGTCTCTGG - Intronic
918014597 1:180620979-180621001 TTCAGATGGAAGGGAGCCAGAGG + Intergenic
918101811 1:181382891-181382913 TGCAGAAGGGGCGGAGGCTTAGG + Intergenic
918746542 1:188208623-188208645 TGCAAAAGGAACAAAGCCAGAGG + Intergenic
919727013 1:200891166-200891188 GGAAGAATGAAAGGAGCCTGCGG - Intronic
919906500 1:202082186-202082208 TGCAGATGGAACAGAGCCAAGGG + Intergenic
921895824 1:220399499-220399521 TGCAAAAGGAACAAAGCCAGAGG - Intergenic
923033511 1:230267977-230267999 TGTAGAAGGAACACAGCCAGCGG - Intronic
923848293 1:237762590-237762612 TGACGAAGGAAAGGAGGCTGAGG - Intronic
1063102432 10:2962455-2962477 TCCAGAAGGAACTGACCCTGAGG - Intergenic
1064838949 10:19568083-19568105 AGGAGAAGGAACGTGGCCTGGGG - Intronic
1065211288 10:23405842-23405864 TGCAGCCGGAAAGGTGCCTGTGG + Intergenic
1065747199 10:28853381-28853403 GCCAGAAGGAAGGGAGTCTGAGG - Intronic
1067116285 10:43437465-43437487 ACCAGAAGGAACCGAGTCTGAGG + Intronic
1067750770 10:48969712-48969734 TGGAGTAGGAATGGGGCCTGAGG - Intronic
1068605409 10:58999892-58999914 TGGAGTAAGAACTGAGCCTGTGG + Intergenic
1069798700 10:71069279-71069301 TGCAGAAGGCAGGGAGCCAGTGG + Intergenic
1070341265 10:75500389-75500411 TACAGAAGAAACTGAGGCTGAGG + Intronic
1070610903 10:77931752-77931774 TGCAGGAGGGAAGGAGCATGGGG - Intergenic
1070680615 10:78446432-78446454 TGCAGAAGGAAAGGAGCCGATGG + Intergenic
1070983258 10:80667018-80667040 TGTAGGAGGGAGGGAGCCTGAGG + Intergenic
1071270875 10:84006235-84006257 TTCAGAAGGAGAGGTGCCTGTGG + Intergenic
1071444990 10:85737163-85737185 TGCACAAGGAATTGAGCCTTTGG + Intronic
1072251556 10:93585976-93585998 TGCAAAAGGAAAGGAACCTAGGG + Intronic
1072339962 10:94437690-94437712 AGAAAAAGGAACAGAGCCTGAGG - Intronic
1073146683 10:101285929-101285951 GGGAGAGGGAAGGGAGCCTGGGG - Intergenic
1073291918 10:102417322-102417344 GGCAGAAGGAAAGGAGCCAGGGG - Intronic
1075257017 10:120933386-120933408 GGCCGAAGGTACTGAGCCTGTGG - Intergenic
1075830950 10:125410298-125410320 TGCAGAAGGTTCTGAGCCAGAGG - Intergenic
1076152900 10:128177889-128177911 TGCAGCAGAAACGCAGGCTGTGG - Intergenic
1076319090 10:129564908-129564930 TGCTGGAGGAAGGGACCCTGAGG - Intronic
1076899444 10:133330186-133330208 TGCAGTAGACACGGAACCTGTGG + Intronic
1077346670 11:2061550-2061572 TGTATAAGGAATGGAGCATGGGG - Intergenic
1077632824 11:3822676-3822698 TGCAGAAGGCTTGGAACCTGAGG - Intronic
1078423336 11:11229947-11229969 TGCAGAAGGGATGGGGCCTAGGG + Intergenic
1078512237 11:11994081-11994103 TGCAGAATGAAAGCAGCCCGAGG + Intronic
1078896140 11:15599015-15599037 TGCAGAAGGAGGGAAGCTTGTGG - Intergenic
1081617812 11:44600980-44601002 GGCAGAAGGAAAGGGGCCTAAGG + Intronic
1082812119 11:57484654-57484676 TTCAGAAGGAAAGGGGCCTGAGG - Exonic
1083731929 11:64656982-64657004 TGAAGAGGGAGCGGAGGCTGCGG - Intronic
1086846399 11:91755065-91755087 TTCAAAAGGAAAGGAGGCTGGGG - Intergenic
1088731926 11:112690900-112690922 TGCAGTTGGAAGGGATCCTGGGG + Intergenic
1090423915 11:126594064-126594086 GACAGAGGGAAGGGAGCCTGGGG - Intronic
1091308287 11:134554938-134554960 AGCTGCAGGAACGGTGCCTGAGG - Intergenic
1091717934 12:2793328-2793350 TGCAGAAGTAACAGTGCCAGGGG - Intergenic
1092168755 12:6360176-6360198 TGCAGAAGGAAGGGAGGATTTGG + Intronic
1094453149 12:30603373-30603395 AGCAGAAGGAACAAAGCCAGAGG + Intergenic
1095182141 12:39158527-39158549 TGCAGAAGGCAAGGAGTCAGAGG + Intergenic
1095513547 12:42980194-42980216 AGCACAGGGAACGAAGCCTGAGG + Intergenic
1095968339 12:47884108-47884130 AGCACCAGGAAAGGAGCCTGAGG - Intronic
1098172237 12:67758607-67758629 TGCAGATGGAGCAGAGCCAGTGG - Intergenic
1098689541 12:73469322-73469344 AGCAGAAAGAACAAAGCCTGAGG - Intergenic
1098807211 12:75035123-75035145 TGTATAAGTAACTGAGCCTGAGG + Intergenic
1101086142 12:101238983-101239005 TGCAGATGGCAGGCAGCCTGGGG + Intergenic
1101327608 12:103729788-103729810 TGCAGAAGGAAAAAAGCCAGGGG + Intronic
1102879015 12:116470045-116470067 TCCAGAAGGAACCGACCCTGAGG + Intergenic
1104018433 12:124975736-124975758 GCTAGAAGGAACGGGGCCTGGGG + Intronic
1104298759 12:127543212-127543234 GGGAGAGGGAAGGGAGCCTGGGG + Intergenic
1104402613 12:128489118-128489140 AGGAGAAGGAACGGAGACAGAGG - Intronic
1104850144 12:131868786-131868808 TGCACAAGAAAGGGAGGCTGGGG - Intergenic
1107175640 13:37395182-37395204 TGGAGAAGGAACAGAGCCTGAGG + Intergenic
1107435431 13:40376941-40376963 TGAAGAAGGAAGGGGTCCTGGGG - Intergenic
1111276184 13:85950441-85950463 TGCAGAAGGAATTGAGCGTAAGG - Intergenic
1111869998 13:93819327-93819349 TGAAGAAGGAACGGGAGCTGGGG + Intronic
1112561877 13:100522462-100522484 TGCAGAGGAAACGGTGCCAGTGG - Intronic
1113432673 13:110264205-110264227 TGAAGAAGGACCAGAGTCTGCGG - Intronic
1114244754 14:20902337-20902359 TGCAGAAGGAAGAGAGCAGGAGG - Intergenic
1116452316 14:45080429-45080451 TGCAGAGGGAGAGGAGCCAGCGG + Intergenic
1121974454 14:98390043-98390065 TGCAGAAGGAACAAACCCTGTGG - Intergenic
1122148270 14:99707077-99707099 TGCAGAGGGAAGGCAGCCTTTGG - Intronic
1122433791 14:101677774-101677796 AGCTGAGGGAAGGGAGCCTGTGG + Intergenic
1122855116 14:104556422-104556444 TGCAGGAGGCTGGGAGCCTGGGG - Intronic
1123976433 15:25558506-25558528 TACAGAAGGAGTGGGGCCTGGGG + Intergenic
1124015588 15:25872003-25872025 TGGAGAACGAAGGGAGCCGGTGG + Intergenic
1125728383 15:41879733-41879755 AGCAGGAGGAACTGAGCCAGAGG - Exonic
1125756715 15:42069953-42069975 TGCAGCAGGATCGGGGCCTCGGG + Exonic
1130304041 15:82700832-82700854 TGCAGATGGATGGGAGTCTGGGG - Intronic
1130581534 15:85141532-85141554 TACAGAAGGAACCAACCCTGTGG - Intergenic
1131070203 15:89461267-89461289 GGCACAGGGAACGGGGCCTGAGG - Intergenic
1132700191 16:1218964-1218986 CACAGAGGCAACGGAGCCTGGGG - Exonic
1133210647 16:4261721-4261743 TGCAGAGGGCGTGGAGCCTGGGG - Intronic
1134070535 16:11256943-11256965 TGCGGAAGAAACTGAGGCTGGGG + Intronic
1137714675 16:50591480-50591502 CAGAGGAGGAACGGAGCCTGGGG + Intronic
1138558396 16:57786135-57786157 TGCAGAAAGAGGGGAGCCAGGGG + Intronic
1138616588 16:58172440-58172462 TGTAGAAGCAACTGAGGCTGAGG - Intronic
1139175701 16:64684582-64684604 TGGAGAAAGACAGGAGCCTGAGG - Intergenic
1140926804 16:79590873-79590895 TGCAGAAGGAAAGCAGGCCGAGG - Intronic
1141005552 16:80348381-80348403 TGTAGAAGATACGGAGCCTTGGG + Intergenic
1141557427 16:84845381-84845403 TGCATAAGGAGAGGAGACTGGGG + Intronic
1141861201 16:86717818-86717840 TGCAGGAGGCAGGGGGCCTGGGG - Intergenic
1142169659 16:88615037-88615059 GGCAGAGGGAACGGAGCAGGTGG - Intronic
1142169671 16:88615074-88615096 GGCAGAGGGAACGGAGCAGGTGG - Intronic
1142169683 16:88615111-88615133 GGCAGAGGGAACGGAGCAGGTGG - Intronic
1142172259 16:88628882-88628904 GGCAGAGGGACGGGAGCCTGGGG + Intronic
1143668855 17:8382922-8382944 AGCTGAGGGAAGGGAGCCTGTGG - Exonic
1143756522 17:9071862-9071884 TGCAGTATGAATGGAGGCTGGGG + Intronic
1143845650 17:9771312-9771334 CCCAGAAGCTACGGAGCCTGGGG - Intergenic
1145771656 17:27497548-27497570 TGCAGAAGGCCGGGATCCTGCGG - Intronic
1145795446 17:27652968-27652990 TGCAGAGGGAAGGGGGCCTACGG - Intergenic
1146581755 17:34044713-34044735 AGTTGAAGGAACGGTGCCTGGGG + Intronic
1146751935 17:35389705-35389727 TGGGGAAGAAACAGAGCCTGAGG - Intergenic
1147886558 17:43688224-43688246 TGCAGAAGCACTGCAGCCTGCGG - Intergenic
1150682335 17:67293859-67293881 TGCAAAGGGAGCGCAGCCTGAGG + Intergenic
1152476663 17:80522854-80522876 TGGAGGAGGTCCGGAGCCTGGGG + Intergenic
1154141281 18:11826565-11826587 TGCAGAAGGCAGAGACCCTGTGG + Intronic
1157307557 18:46528292-46528314 AGGAGAAGGAAAGGAGGCTGAGG + Intronic
1158558168 18:58492100-58492122 GGCAGAGGGGAAGGAGCCTGTGG - Intronic
1158674521 18:59506313-59506335 TCCAGAAGGAACCAACCCTGAGG + Intronic
1160566308 18:79788484-79788506 TGGAGAAGGAATGGGTCCTGCGG - Intergenic
1160733391 19:651207-651229 TCCTGGTGGAACGGAGCCTGGGG - Intronic
1160733406 19:651250-651272 TCCTGGTGGAACGGAGCCTGGGG - Intronic
1160777324 19:862180-862202 TGGAGAAGGTACGGGGCCTCTGG + Intronic
1160796625 19:948590-948612 TGAAGACGGAGCAGAGCCTGGGG - Intronic
1161752539 19:6108918-6108940 ACCAAAAGGAACGGAGCCGGAGG + Intronic
1162383300 19:10345161-10345183 CGTAAAGGGAACGGAGCCTGTGG + Intergenic
1163723102 19:18907510-18907532 TGCAGAAGGATGGGAGCCCTGGG + Intronic
1164542640 19:29132334-29132356 TTCAGAGGGAAGGGAGCCTGAGG + Intergenic
1165144640 19:33723616-33723638 TGTAGAAGGAAGGCAGTCTGAGG + Intronic
1165148519 19:33747971-33747993 TGGAGAAGGAACATGGCCTGGGG + Intronic
1166751410 19:45165478-45165500 TGGAGGAGGAAGGGAGCCTGGGG - Intronic
1167668609 19:50837015-50837037 TCCAGAAGGAACGGAGGCCGTGG - Intronic
1168485461 19:56758731-56758753 TGCAGAAGGAATTGATTCTGAGG + Intergenic
925454833 2:4007260-4007282 TGCAGCAGGACAGGAGCCTGAGG + Intergenic
925685948 2:6473713-6473735 TGCAGAAGGACCTGAGCCACCGG + Intergenic
926139034 2:10357469-10357491 TGCAGAGGGAGTGGACCCTGTGG + Intronic
926477161 2:13338061-13338083 AGCAAAAGGAACAGAGCCTGAGG - Intergenic
927174531 2:20396272-20396294 GGCAGGAGGGACAGAGCCTGTGG + Intergenic
927303038 2:21537689-21537711 AGCAGAAGGAAGGGAGAGTGGGG + Intergenic
928106787 2:28475672-28475694 TGCAGAATGAAGGGAGCTTGAGG - Intronic
928391417 2:30913583-30913605 AGCAGAAGGTCCTGAGCCTGTGG - Intronic
928879336 2:36079874-36079896 TGCAGGAGGAACTGAGCAGGGGG - Intergenic
930478482 2:51915977-51915999 AGCAGAAGGAACAAAGCCGGAGG + Intergenic
931650932 2:64468172-64468194 TGCATAAGGAAGGGAGCCAGGGG - Intergenic
932699341 2:73982659-73982681 TGCAGAAGGAAGGATGCCTGGGG - Intergenic
934658743 2:96132008-96132030 GGCAGAAGGAACACAGACTGTGG - Intronic
934934270 2:98453267-98453289 TGCGGAAGGAAGGGCACCTGAGG + Intronic
935084533 2:99831960-99831982 TGCAGAAGGCACTGAGCGGGTGG - Intronic
935386566 2:102505490-102505512 TGCAGCAGGACCGGAGACTCTGG - Intronic
935444380 2:103140638-103140660 TGCAGAAGGTAGAGAGGCTGAGG - Intergenic
936110293 2:109659431-109659453 TTGAGATGGAAAGGAGCCTGGGG - Intergenic
938256585 2:129864078-129864100 TGCAGATGGACCAGAGGCTGAGG + Intergenic
940931007 2:159430936-159430958 GGCAGCAGGAGCAGAGCCTGGGG + Exonic
942060336 2:172223512-172223534 TGAAGAAAGTACAGAGCCTGGGG - Intergenic
942555286 2:177166651-177166673 AGCATAAAGAACGCAGCCTGGGG - Intergenic
942607383 2:177707193-177707215 TACAGGAGGAACTGAGCCTCAGG - Intronic
943820492 2:192315056-192315078 TGCACATGCCACGGAGCCTGTGG - Intergenic
947714526 2:232333012-232333034 AGCAGAAGCCAAGGAGCCTGTGG - Intronic
948230117 2:236343093-236343115 TGAAGAAGCAGCCGAGCCTGCGG - Intronic
948686003 2:239670140-239670162 AGCAGCAGGAAAGGGGCCTGCGG - Intergenic
948767455 2:240230626-240230648 TGAAGAAGGGAAGGGGCCTGGGG + Intergenic
948808380 2:240462709-240462731 TGCAGGAGGGACTGAGGCTGTGG - Intronic
1170213564 20:13869133-13869155 TGCAAAAGGAAAGGAGCAAGAGG - Intronic
1170869945 20:20196197-20196219 AGCACAAGAGACGGAGCCTGTGG - Intronic
1171144467 20:22769573-22769595 TGCAGTGGGAAAGCAGCCTGTGG - Intergenic
1173250875 20:41363659-41363681 TGCTGTAGGAAGGGGGCCTGGGG + Exonic
1174522112 20:51139592-51139614 TGCAGCAGGAAAGCAGCCCGAGG + Intergenic
1175065101 20:56277485-56277507 TGGAGAAGGCCTGGAGCCTGGGG + Intergenic
1175127760 20:56765058-56765080 TGCAGACTGAACGGGGACTGTGG + Intergenic
1177856337 21:26404588-26404610 AGCAGCAGGAACAGAGCTTGGGG - Intergenic
1178181004 21:30161546-30161568 TTCAGAAGGAACTAACCCTGCGG - Intergenic
1180115423 21:45700537-45700559 TGCAGAAGGAACTGTCCCTGTGG - Intronic
1180244258 21:46536254-46536276 GGCAGAAAGGACAGAGCCTGGGG - Intronic
1181944092 22:26502026-26502048 TTCAGAAGGAGCTGAGCCAGTGG - Exonic
1182594297 22:31406392-31406414 TGCAGAATGAAAGAAGCCTATGG - Intronic
1183641763 22:39097117-39097139 TAGAGAAAGAAAGGAGCCTGAGG + Intergenic
1183832409 22:40425342-40425364 TACAGAAGGAACTGAGGCAGTGG + Intronic
1184421869 22:44386842-44386864 TGCAGGAGCTACTGAGCCTGGGG - Intergenic
1184799533 22:46751328-46751350 GGGAGAAGGGAGGGAGCCTGAGG - Intergenic
949932147 3:9087589-9087611 GGCAGGAGGCACGGAGACTGGGG + Intronic
951687727 3:25363239-25363261 TAGAGAAGGAACGTAGGCTGTGG + Intronic
953677086 3:45011284-45011306 TGCACAAGGAAGAAAGCCTGGGG + Exonic
954086152 3:48245521-48245543 TGTAGAAGGGACAGAGTCTGGGG - Intronic
954422204 3:50424725-50424747 AGCTGAAGCAACGGAACCTGAGG + Intronic
955355833 3:58231894-58231916 TGCAAAAGGAACGGAGCATATGG - Intergenic
955907915 3:63826976-63826998 TGCAGAAGGCACTAAACCTGAGG - Intronic
960075906 3:113484991-113485013 TCCAGGAGGGACTGAGCCTGAGG + Intronic
960106612 3:113804568-113804590 TGAAGAAGGAACTGAGCCAATGG + Intronic
961017154 3:123477112-123477134 TGGAGGAGGAAGGCAGCCTGAGG - Intergenic
962705993 3:138045215-138045237 GGCAGAACAAAAGGAGCCTGGGG + Intergenic
964165580 3:153700983-153701005 TGCAGAAGGAAGAGAGAATGGGG - Intergenic
966428957 3:179811031-179811053 TGATGAAGTAACGGTGCCTGGGG - Intronic
966608997 3:181849820-181849842 TGCAGAAGGCAGGGAGCCAGGGG + Intergenic
967989148 3:195118509-195118531 GGCAGAAGGAACGGAAGATGAGG + Intronic
968073659 3:195803882-195803904 TGCAGAGGGCTCTGAGCCTGAGG + Intronic
968752023 4:2395184-2395206 TGCAGAAGGAACCGAGATGGGGG - Intronic
971422780 4:26489314-26489336 TGCAGAAGAGACAGAGCATGAGG + Exonic
972148601 4:36061372-36061394 TGCAGAAGGATGGCAGCCAGAGG - Intronic
975404085 4:73969135-73969157 TGGGGAAGAAACTGAGCCTGAGG + Intergenic
975695430 4:77008193-77008215 TGGAGAAAGAAAGGGGCCTGGGG + Intronic
978189325 4:105895129-105895151 TGGAGGAGGAAAGGAGCCCGAGG - Intronic
985779072 5:1860394-1860416 TGCAGAAAGATTGGACCCTGTGG - Intergenic
986599932 5:9462830-9462852 TGCAGAGGGAAAGGAGACAGGGG + Intronic
987057699 5:14210369-14210391 AGCAGAGGGTGCGGAGCCTGGGG - Intronic
987059853 5:14232261-14232283 GGCAGAAGGAACGGAGGCTATGG - Intronic
987318299 5:16744640-16744662 TGCAGAGGGAGCGGTGGCTGGGG + Intronic
987401878 5:17486414-17486436 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987403124 5:17498412-17498434 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987405305 5:17518548-17518570 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987405750 5:17521982-17522004 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987406197 5:17525416-17525438 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987407502 5:17585555-17585577 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987408200 5:17590757-17590779 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987408648 5:17594191-17594213 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987409104 5:17597625-17597647 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987412893 5:17632269-17632291 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987413167 5:17634641-17634663 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987414550 5:17649227-17649249 TGCAGGAGGAACTGAGGCTGAGG - Intergenic
988937864 5:36107078-36107100 TGCAGAAGGAATTCAGCTTGGGG - Intronic
990341752 5:54830315-54830337 TGGAGGAGGAATGAAGCCTGGGG - Intergenic
990412012 5:55550718-55550740 GGTAAAGGGAACGGAGCCTGTGG - Intergenic
990489833 5:56293938-56293960 TGCAGCAGGAACCGAGCTTGAGG + Intergenic
990489972 5:56294964-56294986 TGCAGCAGGAACCGAGCTTGAGG - Intergenic
994356213 5:98796541-98796563 TGCAGAAGAAAGGGAGTCGGGGG + Intronic
995565600 5:113430801-113430823 TGCAGATGGAACTGATCATGAGG + Intronic
996120912 5:119671111-119671133 AGCAGAAGGAAGAGAGACTGAGG - Intergenic
999139699 5:149350985-149351007 TTCTGAAGAATCGGAGCCTGAGG + Exonic
1002397921 5:178972430-178972452 TGCAGTAGGGACAGTGCCTGGGG - Intergenic
1002607483 5:180391639-180391661 TCCACAAGGAAGGGAGGCTGGGG - Intergenic
1003272806 6:4622154-4622176 TGGAGACAGAAAGGAGCCTGGGG + Intergenic
1004628022 6:17394292-17394314 TGCAGAGGCAACTGAGACTGGGG + Intronic
1005387006 6:25294923-25294945 TGAAGAGGGTATGGAGCCTGTGG + Intronic
1005920482 6:30396968-30396990 GGCAGAAGGGGCGGAGCCTGAGG - Intergenic
1006079616 6:31557885-31557907 TGCAGATGGAAAGCAGCCAGTGG - Intronic
1006427807 6:33977024-33977046 TGAAGCAGGCAAGGAGCCTGTGG - Intergenic
1006436435 6:34028065-34028087 TGCAAAAGGAGCGGGGCCTGGGG + Intronic
1010697604 6:78996056-78996078 TGCACATGGAAGGGAACCTGAGG - Intronic
1010943415 6:81947017-81947039 AGCAGAAGGTGGGGAGCCTGAGG - Intergenic
1011234190 6:85197738-85197760 TGCAGAAAGAATGGAAACTGAGG + Intergenic
1012731225 6:102885029-102885051 TGAAAAAGGAAAGGAGCCTCTGG + Intergenic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1016609219 6:145969574-145969596 GGCAGAAGGAACACAGCTTGAGG - Intergenic
1018117964 6:160606462-160606484 TGAACAAGGTAAGGAGCCTGTGG - Exonic
1018258757 6:161949071-161949093 TGCTGGATGAACAGAGCCTGGGG + Intronic
1018347956 6:162922182-162922204 TGCAGAGGGAGCAGTGCCTGGGG + Intronic
1018461085 6:163998934-163998956 AGCAGAAGGAGGGGAGGCTGAGG - Intergenic
1018942560 6:168319322-168319344 TGCCGAAGGAGCAGCGCCTGTGG + Intronic
1021445634 7:20730878-20730900 TACAGAAGGAACGGGGCCCTGGG - Intronic
1022182917 7:27939570-27939592 TGGAGAAGGAAAAAAGCCTGAGG - Intronic
1022531585 7:31070192-31070214 TGCAGAAGGAACGGAGCCTGGGG - Intronic
1023853314 7:44162948-44162970 AACAGATGGAATGGAGCCTGGGG + Intronic
1023950691 7:44841844-44841866 TGTAGAAGGAAAGGAACCAGCGG - Intronic
1024058444 7:45681378-45681400 TTCAGAAGGAAAGGAGCTAGTGG - Intronic
1024242738 7:47448025-47448047 GGCAGAAGGAGGGGAGGCTGTGG + Intronic
1024426124 7:49228630-49228652 TGCATAAGGAAGTGGGCCTGGGG + Intergenic
1024551329 7:50564927-50564949 TACAGAAGAAACAGAGGCTGGGG + Intronic
1026105532 7:67417883-67417905 TGGAGAAGCCACAGAGCCTGCGG - Intergenic
1026263195 7:68773493-68773515 TGCAGAAGGAACGGCCACAGTGG + Intergenic
1026535532 7:71235787-71235809 TGAAGAAGGAGTGGAGCTTGAGG - Intronic
1026843264 7:73682875-73682897 TGGAGCGGGAACGGCGCCTGAGG - Exonic
1026849777 7:73717509-73717531 TCCAGAGGGAAAGCAGCCTGTGG + Intronic
1031041569 7:116843642-116843664 TGGAGAAGGCTAGGAGCCTGGGG - Intronic
1031998241 7:128246875-128246897 AGGAGAAGGAAGGCAGCCTGTGG + Intronic
1032084086 7:128874536-128874558 TGCAGATGGAGTGGAGCCGGCGG - Intronic
1032465345 7:132140885-132140907 TGGAGAAGGAGAGAAGCCTGGGG + Intronic
1034417440 7:150972449-150972471 GGCAGAAGAAGCGGAGGCTGAGG + Intronic
1034546470 7:151792926-151792948 TGCAGCAGGGAGGGAGCCGGGGG + Intronic
1035031836 7:155865869-155865891 TCCAGAAGGAAGGGAGGCAGGGG + Intergenic
1035396005 7:158535035-158535057 TGCAGGAGGAACAGAGGCTTTGG - Intronic
1036698994 8:10998819-10998841 GGCAGAAGGAACAGAATCTGTGG - Intronic
1037458210 8:19084157-19084179 AGCAGAAGAAAGGGAGCCAGGGG - Intronic
1038292984 8:26266463-26266485 TGCAGAAGGAAGGGAGCTCTAGG + Intergenic
1039493291 8:37963857-37963879 GGCAGAAGGAATGGAACCAGGGG + Exonic
1044378538 8:91504455-91504477 TGGAGAAGGCAAGGAGCCTCAGG + Intergenic
1048592448 8:135833369-135833391 TGCAGAAAGGAAGGAGTCTGTGG - Intergenic
1048963333 8:139597620-139597642 TGGAGAAGGGCCGGAGCCTAGGG - Intergenic
1052740071 9:32384525-32384547 CGAAGAAGGGGCGGAGCCTGCGG - Intergenic
1053174839 9:35915249-35915271 TTCAGGAGGAAGGGAGCCAGGGG + Intergenic
1053449299 9:38179912-38179934 TGCAGGAGGAACGGAGGCTCTGG + Intergenic
1057426404 9:94953673-94953695 TGCAGAAGGTATGCAGCCTTTGG - Intronic
1057777218 9:98020888-98020910 TCCAGCAGGAAGGGAGCCTAAGG - Intergenic
1059356026 9:113700093-113700115 TACTGAAGGAAGGGAGACTGAGG - Intergenic
1061092004 9:128431794-128431816 AGCAGAAAGAAGGAAGCCTGGGG + Intronic
1061497712 9:130985081-130985103 TCCTGAAGGACAGGAGCCTGAGG - Intergenic
1061731148 9:132615021-132615043 TGCAGAAGGAACAGGGGCTGTGG + Intronic
1061866271 9:133493231-133493253 TGCAGATGGACAGAAGCCTGAGG - Intergenic
1062687244 9:137820136-137820158 GGCTGCAGGGACGGAGCCTGGGG - Intronic
1186886183 X:13916074-13916096 TACAGCAGGAAGGGCGCCTGAGG + Intronic
1189356104 X:40310816-40310838 AGCAGAGGGAGCGGAGACTGGGG + Intergenic
1189372444 X:40439609-40439631 TGCAGAAGCTAAGGAGCCAGAGG - Intergenic
1192926927 X:75764557-75764579 AGCAGAAAGAACAAAGCCTGAGG + Intergenic
1193425513 X:81337200-81337222 TGAAGAAGAAACAGAGCCTGAGG - Intergenic
1193569848 X:83128443-83128465 TGGAGAGGAAACAGAGCCTGAGG + Intergenic
1196051857 X:111314032-111314054 TGCAGAAGGAATGTATCCTCAGG - Intronic
1196540001 X:116896557-116896579 TGCAGAAAGAACAGACCATGAGG + Intergenic
1196711813 X:118770688-118770710 TGCTGAAGATGCGGAGCCTGTGG - Intronic
1197832878 X:130663584-130663606 TGCAGGAGGAAGGGAGCCTCTGG - Intronic
1198411389 X:136373043-136373065 TGAAGAAGGCACAGACCCTGAGG + Exonic
1200160067 X:154002546-154002568 GGCAGAGGGACCGGAACCTGTGG - Intergenic
1200226458 X:154420347-154420369 TGCAGGAGGAGCTGAGCATGAGG + Intronic