ID: 1022536613

View in Genome Browser
Species Human (GRCh38)
Location 7:31102419-31102441
Sequence GGTCCAGGTGTCCTAGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022536605_1022536613 8 Left 1022536605 7:31102388-31102410 CCCCTATAGAGCAGGACCCACAA No data
Right 1022536613 7:31102419-31102441 GGTCCAGGTGTCCTAGCTGTGGG 0: 1
1: 0
2: 1
3: 5
4: 137
1022536606_1022536613 7 Left 1022536606 7:31102389-31102411 CCCTATAGAGCAGGACCCACAAG No data
Right 1022536613 7:31102419-31102441 GGTCCAGGTGTCCTAGCTGTGGG 0: 1
1: 0
2: 1
3: 5
4: 137
1022536609_1022536613 -8 Left 1022536609 7:31102404-31102426 CCCACAAGTGCACATGGTCCAGG No data
Right 1022536613 7:31102419-31102441 GGTCCAGGTGTCCTAGCTGTGGG 0: 1
1: 0
2: 1
3: 5
4: 137
1022536611_1022536613 -9 Left 1022536611 7:31102405-31102427 CCACAAGTGCACATGGTCCAGGT No data
Right 1022536613 7:31102419-31102441 GGTCCAGGTGTCCTAGCTGTGGG 0: 1
1: 0
2: 1
3: 5
4: 137
1022536607_1022536613 6 Left 1022536607 7:31102390-31102412 CCTATAGAGCAGGACCCACAAGT No data
Right 1022536613 7:31102419-31102441 GGTCCAGGTGTCCTAGCTGTGGG 0: 1
1: 0
2: 1
3: 5
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022536613 Original CRISPR GGTCCAGGTGTCCTAGCTGT GGG Intronic