ID: 1022539573

View in Genome Browser
Species Human (GRCh38)
Location 7:31123406-31123428
Sequence GCAACCCAACCTGCAGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022539573_1022539578 16 Left 1022539573 7:31123406-31123428 CCAGCGGCTGCAGGTTGGGTTGC No data
Right 1022539578 7:31123445-31123467 CCTCTTCTGCAGACAATTGCTGG No data
1022539573_1022539580 30 Left 1022539573 7:31123406-31123428 CCAGCGGCTGCAGGTTGGGTTGC No data
Right 1022539580 7:31123459-31123481 AATTGCTGGCAGATTTCTGAGGG No data
1022539573_1022539579 29 Left 1022539573 7:31123406-31123428 CCAGCGGCTGCAGGTTGGGTTGC No data
Right 1022539579 7:31123458-31123480 CAATTGCTGGCAGATTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022539573 Original CRISPR GCAACCCAACCTGCAGCCGC TGG (reversed) Intergenic
No off target data available for this crispr