ID: 1022539574

View in Genome Browser
Species Human (GRCh38)
Location 7:31123439-31123461
Sequence ATTGTCTGCAGAAGAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022539574_1022539580 -3 Left 1022539574 7:31123439-31123461 CCCTGCCCTCTTCTGCAGACAAT No data
Right 1022539580 7:31123459-31123481 AATTGCTGGCAGATTTCTGAGGG No data
1022539574_1022539581 -2 Left 1022539574 7:31123439-31123461 CCCTGCCCTCTTCTGCAGACAAT No data
Right 1022539581 7:31123460-31123482 ATTGCTGGCAGATTTCTGAGGGG No data
1022539574_1022539584 30 Left 1022539574 7:31123439-31123461 CCCTGCCCTCTTCTGCAGACAAT No data
Right 1022539584 7:31123492-31123514 CCCCTTCACCTTTCTCATCCAGG No data
1022539574_1022539579 -4 Left 1022539574 7:31123439-31123461 CCCTGCCCTCTTCTGCAGACAAT No data
Right 1022539579 7:31123458-31123480 CAATTGCTGGCAGATTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022539574 Original CRISPR ATTGTCTGCAGAAGAGGGCA GGG (reversed) Intergenic
No off target data available for this crispr