ID: 1022539577

View in Genome Browser
Species Human (GRCh38)
Location 7:31123445-31123467
Sequence CCAGCAATTGTCTGCAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022539577_1022539579 -10 Left 1022539577 7:31123445-31123467 CCTCTTCTGCAGACAATTGCTGG No data
Right 1022539579 7:31123458-31123480 CAATTGCTGGCAGATTTCTGAGG No data
1022539577_1022539586 25 Left 1022539577 7:31123445-31123467 CCTCTTCTGCAGACAATTGCTGG No data
Right 1022539586 7:31123493-31123515 CCCTTCACCTTTCTCATCCAGGG No data
1022539577_1022539584 24 Left 1022539577 7:31123445-31123467 CCTCTTCTGCAGACAATTGCTGG No data
Right 1022539584 7:31123492-31123514 CCCCTTCACCTTTCTCATCCAGG No data
1022539577_1022539581 -8 Left 1022539577 7:31123445-31123467 CCTCTTCTGCAGACAATTGCTGG No data
Right 1022539581 7:31123460-31123482 ATTGCTGGCAGATTTCTGAGGGG No data
1022539577_1022539588 28 Left 1022539577 7:31123445-31123467 CCTCTTCTGCAGACAATTGCTGG No data
Right 1022539588 7:31123496-31123518 TTCACCTTTCTCATCCAGGGTGG No data
1022539577_1022539580 -9 Left 1022539577 7:31123445-31123467 CCTCTTCTGCAGACAATTGCTGG No data
Right 1022539580 7:31123459-31123481 AATTGCTGGCAGATTTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022539577 Original CRISPR CCAGCAATTGTCTGCAGAAG AGG (reversed) Intergenic
No off target data available for this crispr