ID: 1022539579

View in Genome Browser
Species Human (GRCh38)
Location 7:31123458-31123480
Sequence CAATTGCTGGCAGATTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022539574_1022539579 -4 Left 1022539574 7:31123439-31123461 CCCTGCCCTCTTCTGCAGACAAT No data
Right 1022539579 7:31123458-31123480 CAATTGCTGGCAGATTTCTGAGG No data
1022539577_1022539579 -10 Left 1022539577 7:31123445-31123467 CCTCTTCTGCAGACAATTGCTGG No data
Right 1022539579 7:31123458-31123480 CAATTGCTGGCAGATTTCTGAGG No data
1022539573_1022539579 29 Left 1022539573 7:31123406-31123428 CCAGCGGCTGCAGGTTGGGTTGC No data
Right 1022539579 7:31123458-31123480 CAATTGCTGGCAGATTTCTGAGG No data
1022539575_1022539579 -5 Left 1022539575 7:31123440-31123462 CCTGCCCTCTTCTGCAGACAATT No data
Right 1022539579 7:31123458-31123480 CAATTGCTGGCAGATTTCTGAGG No data
1022539576_1022539579 -9 Left 1022539576 7:31123444-31123466 CCCTCTTCTGCAGACAATTGCTG No data
Right 1022539579 7:31123458-31123480 CAATTGCTGGCAGATTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022539579 Original CRISPR CAATTGCTGGCAGATTTCTG AGG Intergenic
No off target data available for this crispr