ID: 1022539580

View in Genome Browser
Species Human (GRCh38)
Location 7:31123459-31123481
Sequence AATTGCTGGCAGATTTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022539573_1022539580 30 Left 1022539573 7:31123406-31123428 CCAGCGGCTGCAGGTTGGGTTGC No data
Right 1022539580 7:31123459-31123481 AATTGCTGGCAGATTTCTGAGGG No data
1022539577_1022539580 -9 Left 1022539577 7:31123445-31123467 CCTCTTCTGCAGACAATTGCTGG No data
Right 1022539580 7:31123459-31123481 AATTGCTGGCAGATTTCTGAGGG No data
1022539574_1022539580 -3 Left 1022539574 7:31123439-31123461 CCCTGCCCTCTTCTGCAGACAAT No data
Right 1022539580 7:31123459-31123481 AATTGCTGGCAGATTTCTGAGGG No data
1022539576_1022539580 -8 Left 1022539576 7:31123444-31123466 CCCTCTTCTGCAGACAATTGCTG No data
Right 1022539580 7:31123459-31123481 AATTGCTGGCAGATTTCTGAGGG No data
1022539575_1022539580 -4 Left 1022539575 7:31123440-31123462 CCTGCCCTCTTCTGCAGACAATT No data
Right 1022539580 7:31123459-31123481 AATTGCTGGCAGATTTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022539580 Original CRISPR AATTGCTGGCAGATTTCTGA GGG Intergenic
No off target data available for this crispr