ID: 1022539586

View in Genome Browser
Species Human (GRCh38)
Location 7:31123493-31123515
Sequence CCCTTCACCTTTCTCATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022539577_1022539586 25 Left 1022539577 7:31123445-31123467 CCTCTTCTGCAGACAATTGCTGG No data
Right 1022539586 7:31123493-31123515 CCCTTCACCTTTCTCATCCAGGG No data
1022539576_1022539586 26 Left 1022539576 7:31123444-31123466 CCCTCTTCTGCAGACAATTGCTG No data
Right 1022539586 7:31123493-31123515 CCCTTCACCTTTCTCATCCAGGG No data
1022539575_1022539586 30 Left 1022539575 7:31123440-31123462 CCTGCCCTCTTCTGCAGACAATT No data
Right 1022539586 7:31123493-31123515 CCCTTCACCTTTCTCATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022539586 Original CRISPR CCCTTCACCTTTCTCATCCA GGG Intergenic
No off target data available for this crispr