ID: 1022539653

View in Genome Browser
Species Human (GRCh38)
Location 7:31123905-31123927
Sequence AAGAGTGCCCAGCTCATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022539653_1022539657 -10 Left 1022539653 7:31123905-31123927 CCTTCAATGAGCTGGGCACTCTT No data
Right 1022539657 7:31123918-31123940 GGGCACTCTTCCAGGCCTTGGGG No data
1022539653_1022539660 25 Left 1022539653 7:31123905-31123927 CCTTCAATGAGCTGGGCACTCTT No data
Right 1022539660 7:31123953-31123975 TATGACAATCTTGTTATCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022539653 Original CRISPR AAGAGTGCCCAGCTCATTGA AGG (reversed) Intergenic
No off target data available for this crispr