ID: 1022539657 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:31123918-31123940 |
Sequence | GGGCACTCTTCCAGGCCTTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1022539650_1022539657 | 15 | Left | 1022539650 | 7:31123880-31123902 | CCTACTGACACTTATTGACTGAG | No data | ||
Right | 1022539657 | 7:31123918-31123940 | GGGCACTCTTCCAGGCCTTGGGG | No data | ||||
1022539653_1022539657 | -10 | Left | 1022539653 | 7:31123905-31123927 | CCTTCAATGAGCTGGGCACTCTT | No data | ||
Right | 1022539657 | 7:31123918-31123940 | GGGCACTCTTCCAGGCCTTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1022539657 | Original CRISPR | GGGCACTCTTCCAGGCCTTG GGG | Intergenic | ||
No off target data available for this crispr |