ID: 1022539657

View in Genome Browser
Species Human (GRCh38)
Location 7:31123918-31123940
Sequence GGGCACTCTTCCAGGCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022539650_1022539657 15 Left 1022539650 7:31123880-31123902 CCTACTGACACTTATTGACTGAG No data
Right 1022539657 7:31123918-31123940 GGGCACTCTTCCAGGCCTTGGGG No data
1022539653_1022539657 -10 Left 1022539653 7:31123905-31123927 CCTTCAATGAGCTGGGCACTCTT No data
Right 1022539657 7:31123918-31123940 GGGCACTCTTCCAGGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022539657 Original CRISPR GGGCACTCTTCCAGGCCTTG GGG Intergenic
No off target data available for this crispr