ID: 1022539660

View in Genome Browser
Species Human (GRCh38)
Location 7:31123953-31123975
Sequence TATGACAATCTTGTTATCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022539658_1022539660 2 Left 1022539658 7:31123928-31123950 CCAGGCCTTGGGGCATAGCAGCA No data
Right 1022539660 7:31123953-31123975 TATGACAATCTTGTTATCGCTGG No data
1022539653_1022539660 25 Left 1022539653 7:31123905-31123927 CCTTCAATGAGCTGGGCACTCTT No data
Right 1022539660 7:31123953-31123975 TATGACAATCTTGTTATCGCTGG No data
1022539659_1022539660 -3 Left 1022539659 7:31123933-31123955 CCTTGGGGCATAGCAGCAGATAT No data
Right 1022539660 7:31123953-31123975 TATGACAATCTTGTTATCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022539660 Original CRISPR TATGACAATCTTGTTATCGC TGG Intergenic
No off target data available for this crispr